Variant Classification

Introduction

Illumina Connected Annotation follows the VCF Specification when parsing the VCF files. VCF files classify the variants based on alleles and certain INFO fields.

While the VCF variant type does not depend on the size of the variant, (both a ATG->A and A-><DEL> are deletion) for the purpose of annotation, it is useful to classify variants into small and structural (large) variants. This is due to the realization that reporting annotations for a deletion like 1-1000-ATG-A from ClinVar for a 20kbp <DEL> at that same location is not helpful and vice versa. Following guidelines are used by Illumina Connected Annotations.

Structural variants are treated as intervals when providing supplementary annotations such as ClinVar, gnomAD etc.

Non-Informative Alleles

Before classification, the following non-informative ALT alleles are filtered out and skipped entirely:

Allele	Source
<NON_REF>	GATK gVCF reference block
<*>	Symbolic non-ref
*	Missing due to upstream deletion
<M>	Missing allele

Classification Overview

The primary boundary between small and structural variants is the 50bp threshold applied to nucleotide-only alleles.

Category	Criteria	Example
SmallVariant	Nucleotide-only allele AND length <= 50bp	G -> A SNV, T -> TAA insertion
SmallVariant	Non-symbolic allele with no SV metadata (SVTYPE, SVLEN, IMPRECISE all absent)	ACGT -> A without any INFO SV fields
SV_COMPLETE	Symbolic <INS> with SVINSSEQ or DUPSVINSSEQ+SVLEN in INFO	<INS> with SVINSSEQ=ACGTACGT...
SV_COMPLETE	Precise nucleotide allele exceeding the 50bp threshold	200bp explicit ALT with SVTYPE=DEL
SV_INCOMPLETE	Breakend notation ([ or ] in ALT)	N[chr10:1234567[
SV_INCOMPLETE	Symbolic allele without sufficient sequence information	<DEL> with SVTYPE=DEL
CNV	SVTYPE=CNV or SVTYPE=LOH, or LOHTYPE present	<DEL> with SVTYPE=CNV
RepeatExpansion	ALT starts with <STR (repeat count embedded)	<STR12>
ROH	ALT is exactly <ROH>	<ROH> with SVTYPE=ROH
SINGLE_BND	SVTYPE=BND, or ALT uses dot notation	.G or G.
Reference	globalMajorAllele is non-null (ref-minor site)	Ref-minor position from population data

Variant Categories

SmallVariant

Trigger (either condition):

• Alt allele is nucleotide-only (A/C/G/T) AND max allele length (max(ref allele length, alt allele length)) is less than or equal to 50.
• No SV metadata: SVTYPE is absent, SVLEN is absent, IMPRECISE is false, and allele is not symbolic

The specific VariantType is determined after normalization (left-alignment and padding-base trimming):

Condition	VariantType
ref and alt same length, length = 1	SNV
ref and alt same length, length > 1	MNV
ref longer than alt (alt is empty after trim)	deletion
alt longer than ref (ref is empty after trim)	insertion
Different lengths, neither is empty after trim	delins

---

SV_COMPLETE (Complete Structural Variants)

Trigger (any):

• Symbolic <INS> with non-empty SVINSSEQ in INFO
• Symbolic <INS> with non-empty DUPSVINSSEQ and SVLEN in INFO
• Non-symbolic (precise nucleotide sequence) alt allele that exceeds the 50bp threshold

Meaning: The exact breakpoint or inserted sequence is known. Full transcript annotation is performed.

Variant types resolved from SVTYPE:

SVTYPE	VariantType
DEL	deletion (or copy_number_loss if CN field present)
INS	insertion
DUP	tandem_duplication (or copy_number_gain if CN field present)
DUP:TANDEM / TDUP	tandem_duplication
INV	inversion
BND	translocation
ALU / LINE1 / SVA	mobile_element_insertion
UPD	UPD

---

SV_INCOMPLETE (Incomplete Structural Variants)

Trigger:

• Alt allele contains [ or ] (breakend notation, e.g. G]17:198982])
• Symbolic allele (e.g. <DEL>, <DUP>) without sufficient sequence information to classify as complete

Meaning: Imprecise or incomplete structural variant. Reduced transcript annotation is applied because exact boundaries are uncertain.

---

CNV

Trigger (any):

• SVTYPE is "CNV" or "LOH"
• LOHTYPE field is non-empty

Sub-type resolution:

Condition	VariantType
<LOH> + LOHTYPE=CNLOH	copy_number_neutral
<LOH> + LOHTYPE=GAINLOH	copy_number_gain
<LOH> + LOHTYPE=LOSSLOH	copy_number_loss
<DEL> or copyNumber < 1	copy_number_loss
<DUP> or copyNumber > 1	copy_number_gain
Otherwise	copy_number_variation

---

RepeatExpansion

Trigger: Alt allele starts with <STR (e.g. <STR12>). The repeat count is parsed from the digits following STR.

Variant type: short_tandem_repeat_variation.

---

ROH (Run of Homozygosity)

Trigger: Alt allele is exactly <ROH>.

Variant type: run_of_homozygosity.

---

SINGLE_BND (Single Breakend)

Trigger (either):

• SVTYPE is "BND"
• Alt allele starts or ends with . (dot notation, e.g. G. or .G)

Variant type: translocation.

---

Reference (Ref-Minor)

Trigger: globalMajorAllele is non-null (ref-minor site where the reference allele is the minor allele in the population).

Handled by delegating to SmallVariantCreator with isRefMinor = true.

Annotation Behavior

Each variant category is assigned an annotation behavior that determines the scope of transcript and supplementary annotations applied.

Category	Annotation Behavior
SmallVariant	SmallVariants
Reference (Ref-Minor)	SmallVariants
SV_COMPLETE	CompleteStructuralVariants
SV_INCOMPLETE	IncompleteStructuralVariants
CNV	IncompleteStructuralVariants
ROH	RunsOfHomozygosity
SINGLE_BND	BreakendVariants
RepeatExpansion	IncompleteStructuralVariants

Annotation Behavior Descriptions

Annotation Behavior	Description
SmallVariants	Full annotation including transcript consequences, CDS/protein positions, HGVS notation, and supplementary data sources (ClinVar, gnomAD, etc.)
CompleteStructuralVariants	Full annotation including transcript consequences, CDS/protein positions, HGVS notation. Supplementary annotations are matched by interval overlap (e.g. gnomAd SV, ClinVar SV)
IncompleteStructuralVariants	Reduced transcript annotation because exact boundaries are uncertain. Supplementary annotations are matched by interval overlap (e.g. gnomAd SV, ClinVar SV)
RunsOfHomozygosity	Minimal annotation since ROH is a zygosity observation, not a sequence change
BreakendVariants	Breakend-specific annotation

Alt Allele Resolution

Before categorization, symbolic <INS> alleles are resolved to concrete sequences when possible:

1. SVINSSEQ present -- ALT becomes refAllele[0] + SVINSSEQ (anchoring base + inserted sequence).
2. DUPSVINSSEQ + SVLEN present -- Represents a tandem duplication followed by novel insertion:

   • Duplication length = SVLEN - DUPSVINSSEQ.Length
   • Duplicated sequence fetched from the reference at POS
   • ALT = refAllele[0] + duplicatedSequence + DUPSVINSSEQ

If neither field is available, <INS> remains symbolic and categorizes as SV_INCOMPLETE.

Normalization

After categorization, variants are normalized (left-aligned and padding bases trimmed) against the reference sequence.

Exception: SINGLE_BND variants skip normalization. Since single breakends use dot notation (.G or G.), trimming the padding base would make it impossible to reconstruct the original allele.

For SmallVariant and Reference categories, the end position is recalculated after normalization as shiftedStart + shiftedRef.Length - 1.

Examples

Small Variants

SNP

Input Data:

chr1    1234567    .    G    A    .    PASS    .

Classification:

• This is a single nucleotide polymorphism (SNP)
• It does not contain breakend notation or symbolic alleles
• It does not contain SVTYPE or SVLEN in the INFO field

Short Indel

Input Data:

chr2    8901234    .    T    TAA    .    PASS    .

Classification:

• This is an insertion of 2 base pairs
• The length of change is small (3bp), so it falls under small variant
• It does not contain SVTYPE or SVLEN in the INFO field

Multiallelic SNP

Input Data:

chr7    2345678    .    G    A,C    .    PASS    .

Classification:

• This represents a multiallelic SNP, where two different alternative alleles exist (A and C)
• Each allele is processed independently through the classification pipeline
• It does not contain SVTYPE or SVLEN in the INFO field

Structural Variants

Deletion (symbolic)

Input Data:

chr3    3456789    .    N    <DEL>    .    PASS    SVTYPE=DEL;END=3457890

Classification:

• The alternate allele (<DEL>) is symbolic
• The SVTYPE=DEL confirms it is a structural variant
• Category: SV_INCOMPLETE (no precise sequence available)

Deletion with explicit alleles

Input Data:

chr1    934064    .    AGGGGAGGCGGCTGCGTTACAGGTGGGCAGGGGAGGCGGCTCCGTTACAGGTGGGCAGGGGAGGCGGCTGCGTTACA    A    .    .    END=934904;SVTYPE=DEL

Classification:

• The alternate and reference alleles are precise but SVTYPE=DEL indicates it is a structural variant
• Category: SV_COMPLETE (precise nucleotide allele exceeding 50bp)

Run Of Homozygosity

Input Data:

1   4000000    .    N    <ROH>    .    ROHLC    SVTYPE=ROH;END=4001000    GT    .    .    1

Classification:

• The alternate allele (<ROH>) is symbolic
• Category: ROH

Repeat Expansion

Input Data:

chrX    9876543    .    CAG    <STR12>    .    PASS    SVTYPE=STR;REPEAT_UNIT=CAG

Classification:

• The alternate allele <STR12> indicates a repeat expansion with 12 repeats
• Category: RepeatExpansion

Copy Number Variation

Input Data:

chr7    110541589    .    N    <DEL>    27    cnvLength    SVTYPE=CNV;END=110548681;REFLEN=7092

Classification:

• The alternate allele <DEL> is symbolic
• SVTYPE=CNV confirms it is a copy number variant (copy_number_loss)
• Category: CNV

Translocation

Input Data:

chr4    5678901    .    N    N[chr10:1234567[    .    PASS    SVTYPE=BND

Classification:

• The alternate allele contains [ and ], signifying a breakend
• SVTYPE=BND confirms this is a structural variant (translocation)
• Category: SV_INCOMPLETE