> For the complete documentation index, see [llms.txt](https://help.connected.illumina.com/llms.txt). Markdown versions of documentation pages are available by appending `.md` to page URLs; this page is available as [Markdown](https://help.connected.illumina.com/annotation/data-sources/abraom.md).

# ABraOM

### Overview

Illumina Connected Annotation provides allele frequency annotations from [ABraOM](https://ABraOM.ib.usp.br/index.php) which is a repository of genomic variants from individual in Sao Paolo, Brazil.

{% hint style="info" %}
**Publication**

Naslavsky MS, Santos R, Rudan I, et al. ABraOM: A Brazilian database of genomic variants from whole exome sequenced elderly individuals. *Hum Mutat*. 2017;38(7):751-763. doi:10.1002/humu.23211
{% endhint %}

ABraOM has data for both GRCh37 and GRCh38.

| Assembly | Name          | Description                                                                       |
| -------- | ------------- | --------------------------------------------------------------------------------- |
| GRCh37   | SABE609       | ABraOM dataset for GRCh37, coming from exome samples from 609 individuals         |
| GRCh38   | SABE-WGS-1171 | ABraOM dataset for GRCh38, coming from whole genome samples from 1171 individuals |

### Data input

Below are some examples of entry for SABE609 dataset.

```
Chr	Start	Ref	Alt	PredictedFunc.refGene	Gene.refGene	PredConsequence.refGene	avsnp147	FILTER	CEGH Filter	HomozygousALT count	Hemizygous count	Allele number	Allele ALT count	Frequencies	Cohort
1	13116	T	G	ncRNA_intronic	DDX11L1	NA	rs62635286	LowQual	FDP	2	0	598	6	0.010033	SABE609
1	13244	G	A	ncRNA_exonic	DDX11L1	NA	NA	LowQual	FAB	0	0	456	1	0.002193	SABE609
1	13248	C	G	ncRNA_exonic	DDX11L1	NA	NA	VQSRTrancheSNP99.00to99.90	FAB	0	0	482	2	0.004149	SABE609
1	13273	G	C	ncRNA_exonic	DDX11L1	NA	rs531730856	VQSRTrancheSNP99.00to99.90	WK-LowCall	20	0	600	68	0.113333	SABE609
1	13302	C	T	ncRNA_exonic	DDX11L1	NA	rs180734498	VQSRTrancheSNP99.00to99.90	WK-LowCall	1	0	700	12	0.017143	SABE609
1	13380	C	G	ncRNA_exonic	DDX11L1	NA	rs571093408	VQSRTrancheSNP99.00to99.90	FAB	0	0	514	4	0.007782	SABE609
...
```

As for SABE-WGS-1171.

```
Chr	Start	Ref	Alt	PredictedFunc.refGene	Gene.refGene	PredConsequence.refGene	avsnp150	FILTER	CEGH_Filter	HomozygousALT_count	Hemizygous_count	Allele_number	Allele_ALT_count	Frequencies	Cohort
1	10354	C	A	intergenic	DDX11L1;NONE	dist=NONE;dist=1520	rs1015856060	VQSRTrancheSNP99.80to99.90	FDP	6	0	624	12	0.019231	SABE-WGS-1171
1	10378	CCCTAACCCTAACCCCTAACCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC-intergenic	DDX11L1;NONE	dist=NONE;dist=1434		PASS	FDP	20	1080	6	0.005556	SABE-WGS-1171
1	10379	CCTAA	-	intergenic	DDX11L1;NONE	dist=NONE;dist=1491		VQSRTrancheINDEL99.00to99.30	FDP	1	0	1190	20.001681	SABE-WGS-1171
1	10384	CCCTAACCCCTAACCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC	-intergenic	DDX11L1;NONE	dist=NONE;dist=1434		PASS	vSR-LowCall	0	0	1042	1	0.000960	SABE-WGS-1171
1	10390	CCCCTAACCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC	-	intergenic	DDX11L1;NONE	dist=NONE;dist=1434		PASS	vSR-LowCall	0	0	838	1	0.001193	SABE-WGS-1171
1	10390	C	-	intergenic	DDX11L1;NONE	dist=NONE;dist=1484	rs766767872	PASS	FDP	1	0	842	4	0.004751SABE-WGS-1171
1	10391	CCCTAACCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA	-	intergenic	DDX11L1;NONE	dist=NONE;dist=1441		PASS	WK-LowCall	30	0	902	90	0.099778	SABE-WGS-1171
1	10396	AC	-	intergenic	DDX11L1;NONE	dist=NONE;dist=1477		PASS	FDP	0	0	812	1	0.001232	SABE-WGS-1171
1	10398	CCCTAA	-	intergenic	DDX11L1;NONE	dist=NONE;dist=1471		PASS	FDP	9	0	1004	21	0.020916	SABE-WGS-1171
```

### Parsing

From the TSV file, the following columns are parsed out and provided in the annotation output:

| Column               | Description                        | Illumina Connected Annotatyion JSON key |
| -------------------- | ---------------------------------- | --------------------------------------- |
| HomozygousALT\_count | Homozygous alt allele count number | `homozygote`                            |
| Hemizygous\_count    | Hemizygous allele count number     | `hemizygote`                            |
| Allele\_number       | Total allele number                | `allAn`                                 |
| Allele\_ALT\_count   | Number of alt allele               | `allAc`                                 |
| Frequencies          | Frequency of alt allele            | `allAf`                                 |

### Output

ABraOM supplementary data will have `abraom` key in Illumina Connected Annotation JSON output. Below is an example of annotation output from ABraOM.

```
"abraom": {
        "homozygote": 532,
        "hemizygote": 0,
        "allAn": 1164,
        "allAc": 1113,
        "allAf": 0.956186
      }
```


---

# Agent Instructions
This documentation is published with GitBook. GitBook is the documentation platform designed so that both humans and AI agents can read, navigate, and reason over technical content effectively. Learn more at gitbook.com.

## Querying This Documentation
If you need additional information that is not directly available in this page, you can query the documentation dynamically by asking a question.

Perform an HTTP GET request on the current page URL with the `ask` query parameter, and the optional `goal` query parameter:

```
GET https://help.connected.illumina.com/annotation/data-sources/abraom.md?ask=<question>&goal=<endgoal>
```

`ask` is the immediate question: it should be specific, self-contained, and written in natural language.
`goal` is optional and describes the broader end goal you are ultimately trying to accomplish on behalf of the user. GitBook uses it to tailor the answer towards what is most useful for that goal.

The response will contain a direct answer to the question and relevant excerpts and sources from the documentation.

Use this mechanism when the answer is not explicitly present in the current page, you need clarification or additional context, or you want to retrieve related documentation sections.