ClinVar Preview

Overview

ClinVar is a freely accessible, public archive of reports of the relationships among human variations and phenotypes, with supporting evidence. ClinVar thus facilitates access to and communication about the relationships asserted between human variation and observed health status, and the history of that interpretation.

Publication

Melissa J Landrum, Jennifer M Lee, Mark Benson, Garth R Brown, Chen Chao, Shanmuga Chitipiralla, Baoshan Gu, Jennifer Hart, Douglas Hoffman, Wonhee Jang, Karen Karapetyan, Kenneth Katz, Chunlei Liu, Zenith Maddipatla, Adriana Malheiro, Kurt McDaniel, Michael Ovetsky, George Riley, George Zhou, J Bradley Holmes, Brandi L Kattman, Donna R Maglott, ClinVar: improving access to variant interpretations and supporting evidence, Nucleic Acids Research, 46, Issue D1, 4 January 2018, Pages D1062–D1067, https://doi.org/10.1093/nar/gkx1153

ClinVar Preview relates to the new ClinVar XML format introduced in 2024. Following sections describe the parsing and subsequent json format provided by Illumina Connected Annotations.

Parsing

ClinVar recommends using the VCV XML file because it contains comprehensive information.

Parsing is simplified by using the XSD file generation. Command for generating XSD file

xsd ClinVar_VCV.xsd /n:VariationArchive /c

Overall XML to JSON mapping

key	type	description	XML path
variantType	string	sequence ontology	VariationArchive.VariationType
accession	string	VCV Id from ClinVar	VariationArchive.Accession
version	string	VCV Id version	VariationArchive.Version
recordType	string	classified	VariationArchive.RecordType
dateLastUpdated	date time	date VCV was last updated	VariationArchive.DateLastUpdated
chromosome	string	chromosome (large variants only)	VariationArchive.ClassifiedRecord.SimpleAllele.Location.SequenceLocation.Chr
begin	number	start position of the variant (large variants only)	VariationArchive.ClassifiedRecord.SimpleAllele.Location.SequenceLocation.positionVCF
end	number	end position of the variant (large variants only)	VariationArchive.ClassifiedRecord.SimpleAllele.Location.SequenceLocation.displayStop or calculated
refAllele	string	reference alleles (small variants only)	VariationArchive.ClassifiedRecord.SimpleAllele.Location.SequenceLocation.referenceAlleleVCF
altAllele	string	alternate alleles (small variants only)	VariationArchive.ClassifiedRecord.SimpleAllele.Location.SequenceLocation.alternateAlleleVCF
rcvs	list	list of RCV objects	VariationArchive.ClassifiedRecord.RCVList
classifications	list	list of classification objects	VariationArchive.ClassifiedRecord.Classifications
clinicalAssertions	list	list of clinicalAssertion objects	VariationArchive.ClassifiedRecord.ClinicalAssertionList

Variation fields

** XML **

<VariationArchive
    VariationID="1381081"
    VariationName="NM_003000.3(SDHB):c.19_41dup (p.Pro14_Ala15insSerProTer)"
    VariationType="Indel"
    Accession="VCV001381081"
    Version="3"
    RecordType="classified"
    DateLastUpdated="2024-01-26"
    NumberOfSubmissions="1"
    NumberOfSubmitters="1"
    DateCreated="2022-03-28"
    MostRecentSubmission="2023-02-07"
>
...

** JSON **

{
  "variantType": "delins",
  "accession": "VCV001381081",
  "version": "3",
  "recordType": "classified",
  "dateLastUpdated": "2024-01-26",
  ...
}

Location fields

<SimpleAllele
    AlleleID="196495"
    VariationID="1381081"
    >
    <Location>
        <CytogeneticLocation>1p36.13</CytogeneticLocation>
        <SequenceLocation
            Accession="NC_000001.11"
            Chr="1"
            Assembly="GRCh38"
            positionVCF="17053978"
            referenceAlleleVCF="C"
            alternateAlleleVCF="CGGCAACCGGCGCCTCAAGGAGAG"
            display_start="17053978"
            display_stop="17053979"
            AssemblyAccessionVersion="GCF_000001405.38"
            forDisplay="true"
            AssemblyStatus="current"
            start="17053978"
            stop="17053979"
            variantLength="23"
        />
        <SequenceLocation Assembly="GRCh37" AssemblyAccessionVersion="GCF_000001405.25"
                          AssemblyStatus="previous" Chr="1" Accession="NC_000001.10" start="17380473"
                          stop="17380474" display_start="17380473" display_stop="17380474"
                          variantLength="23" positionVCF="17380473" referenceAlleleVCF="C"
                          alternateAlleleVCF="CGGCAACCGGCGCCTCAAGGAGAG"/>
    </Location>
    ...
    </SimpleAllele>

** JSON Small Variant**

note the alleles are trimmed

{
  "altAllele": "GGCAACCGGCGCCTCAAGGAGAG",
  "refAllele": "-",
  ...
}

** JSON Large Variant**

{
  "chromosome": "17",
  "begin": 150732,
  "end": 14764202,
  ...
}

RCVs

RCV Object from XML path VariationArchive.ClassifiedRecord.RCVList

key	type	description	XML sub-path
accession	string	VCV Id from ClinVar	RCVList.RCVAccession.Accession
version	string	VCV Id version	RCVList.RCVAccession.Accession
classifications	list	list of classification objects	RCVList.RCVAccession.RCVClassifications
classifiedConditions	list	list of classified conditions	RCVList.RCVAccession.ClassifiedConditionList

** XML **

<RCVList>
    <RCVAccession
        Title="NM_003000.3(SDHB):c.19_41dup (p.Pro14_Ala15insSerProTer) AND multiple conditions"
        Accession="RCV001921860"
        Version="3">
        <ClassifiedConditionList TraitSetID="23696">
            ...
        </ClassifiedConditionList>
        <RCVClassifications>
            ...
        </RCVClassifications>
    </RCVAccession>
</RCVList>
...

** JSON **

{
  "rcvs": [
    {
      "accession": "RCV001921860",
      "version": "3",
      "classifications": {
        ...
      },
      "classifiedConditions": [
        ...
      ]
    }
  ]
}

Classifications

Classification object from XML path VariationArchive.ClassifiedRecord.RCVList.RCVAccession.RCVClassifications classification can be of following types:

1. germlineClassification
2. somaticClinicalImpact
3. oncogenicityClassification

Germline Classification

Classification object from XML path VariationArchive.ClassifiedRecord.RCVList.RCVAccession.RCVClassifications.GermlineClassification

key	type	description	XML sub-path
reviewStatus	string	review status	GermlineClassification.ReviewStatus
descriptions	list	list of classification objects	GermlineClassification.Description
descriptions[].classification	string	classification	GermlineClassification.Description.Value
descriptions[].dateLastEvaluated	date	date last evaluated	GermlineClassification.Description.DateLastEvaluated

** XML **

<RCVClassifications>
    <GermlineClassification>
        <ReviewStatus>criteria provided, single submitter</ReviewStatus>
        <Description DateLastEvaluated="2021-08-04" SubmissionCount="1">Pathogenic</Description>
    </GermlineClassification>
</RCVClassifications>

** JSON **

{
  "classifications": {
    "germlineClassification": {
      "reviewStatus": "criteria provided, single submitter",
      "descriptions": [
        {
          "dateLastEvaluated": "2021-08-04",
          "classification": "Pathogenic"
        }
      ]
    }
  }
}

Classified Conditions

Classified conditions object from XML path VariationArchive.ClassifiedRecord.RCVList.RCVAccession.ClassifiedConditionList

key	type	description	XML sub-path
condition	string	VCV Id from ClinVar	ClassifiedConditionList.ClassifiedCondition.Value
db	string	list of classification objects	ClassifiedConditionList.ClassifiedCondition.DB
id	string	classification	ClassifiedConditionList.ClassifiedCondition.ID

** XML **

<ClassifiedConditionList TraitSetID="23696">
    <ClassifiedCondition DB="MedGen" ID="C0238198">Gastrointestinal stromal tumor</ClassifiedCondition>
    <ClassifiedCondition DB="MedGen" ID="C1861848">Paragangliomas 4</ClassifiedCondition>
    <ClassifiedCondition DB="MedGen" ID="C0031511">Pheochromocytoma</ClassifiedCondition>
</ClassifiedConditionList>

** JSON **

{
  "classifiedConditions": [
    {
      "condition": "Gastrointestinal stromal tumor",
      "db": "MedGen",
      "id": "C0238198"
    },
    {
      "condition": "Paragangliomas 4",
      "db": "MedGen",
      "id": "C1861848"
    },
    {
      "condition": "Pheochromocytoma",
      "db": "MedGen",
      "id": "C0031511"
    }
  ]
}

Classifications

Classification object from XML path VariationArchive.ClassifiedRecord.Classifications classification can be of following types:

1. germlineClassification
2. somaticClinicalImpact
3. oncogenicityClassification

** XML **

<Classifications>
    <GermlineClassification DateLastEvaluated="2021-08-04" NumberOfSubmissions="1" NumberOfSubmitters="1"
                            DateCreated="2022-03-28" MostRecentSubmission="2023-02-07">
    ...
    </GermlineClassification>
</Classifications>

** JSON **

"classifications": {
    "germlineClassification": {...}
}

Germline Classification

Classification object from XML path VariationArchive.ClassifiedRecord.Classifications.GermlineClassification

key	type	description	XML sub-path
classification	string	classification	GermlineClassification.Description
reviewStatus	string	review status	GermlineClassification.ReviewStatus
dateLastEvaluated	date	date last evaluated	GermlineClassification.DateLastEvaluated
mostRecentSubmission	date	date last evaluated	GermlineClassification.MostRecentSubmission
pubMedIds	list	list of PubMedIds	GermlineClassification.Citation.ID.Value
conditions	list	list of conditions	GermlineClassification.ConditionList

** XML **

<Classifications>
    <GermlineClassification DateLastEvaluated="2021-08-04" NumberOfSubmissions="1" NumberOfSubmitters="1"
                            DateCreated="2022-03-28" MostRecentSubmission="2023-02-07">
        <ReviewStatus>criteria provided, single submitter</ReviewStatus>
        <Description>Pathogenic</Description>
        <Citation Type="general">
            <ID Source="PubMed">19454582</ID>
        </Citation>
        <Citation Type="general">
            <ID Source="PubMed">19802898</ID>
        </Citation>
        <ConditionList>
            ...
        </ConditionList>
    </GermlineClassification>
</Classifications>

** JSON **

{
  "classifications": {
    "germlineClassification": {
      "classification": "Pathogenic",
      "reviewStatus": "criteria provided, single submitter",
      "dateLastEvaluated": "2021-08-04",
      "mostRecentSubmission": "2023-02-07",
      "conditions": [...],
      "pubMedIds": [
        "19454582",
        "19802898"
      ]
    }
  }
}

Conditions

Conditions object from XML path VariationArchive.ClassifiedRecord.Classifications.GermlineClassification.ConditionList

key	type	description	XML sub-path
type	string	classification	ConditionList.TraitSet.Type
contributesToAggregateClassification	True or blank	contributes to aggregate classifcation	ConditionList.TraitSet.ContributesToAggregateClassification
traits	list	trait objects	ConditionList.TraitSet.Trait
traits[].id	date	date last evaluated	ConditionList.TraitSet.Trait
traits[].name	object	trait name object	ConditionList.TraitSet.Trait
traits[].name.value	string	preferred trait name	ConditionList.TraitSet.Trait.Name.ElementValue.Type
traits[].name.xRefs	list	list of cross references	ConditionList.TraitSet.Trait.Name.XRef
traits[].name.xRefs[].db	string	preferred name cross reference database	ConditionList.TraitSet.Trait.Name.XRef.DB
traits[].name.xRefs[].id	string	preferred name cross reference identifier	ConditionList.TraitSet.Trait.Name.XRef.ID

** XML **

<Classifications>
    <GermlineClassification DateLastEvaluated="2021-08-04" NumberOfSubmissions="1" NumberOfSubmitters="1"
                            DateCreated="2022-03-28" MostRecentSubmission="2023-02-07">
        <ConditionList>
            <TraitSet ID="23696" Type="Disease" ContributesToAggregateClassification="true">
                <Trait ID="3796" Type="Disease">
                    <Name>
                        <ElementValue Type="Preferred">Pheochromocytoma</ElementValue>
                        <XRef ID="Pheochromocytoma/5718" DB="Genetic Alliance"/>
                        <XRef ID="HP:0002666" DB="Human Phenotype Ontology"/>
                        <XRef ID="MONDO:0008233" DB="MONDO"/>
                    </Name>
                    <Name>
                        <ElementValue Type="Alternate">Chromaffinoma</ElementValue>
                    </Name>
                    ...
                </Trait>
            </TraitSet>
        </ConditionList>
    </GermlineClassification>
</Classifications>

** JSON **

{
  "classifications": {
    "germlineClassification": {
      "classification": "Pathogenic",
      "reviewStatus": "criteria provided, single submitter",
      "dateLastEvaluated": "2021-08-04",
      "mostRecentSubmission": "2023-02-07",
      "conditions": [
        {
          "type": "Disease",
          "contributesToAggregateClassification": true,
          "traits": [
            {
              "id": "3796",
              "name": {
                "xRefs": [
                  {
                    "db": "Genetic Alliance",
                    "id": "Pheochromocytoma/5718"
                  },
                  {
                    "db": "Human Phenotype Ontology",
                    "id": "HP:0002666"
                  },
                  {
                    "db": "MONDO",
                    "id": "MONDO:0008233"
                  }
                ],
                "value": "Pheochromocytoma"
              }
            }
          ]
        }
      ],
      "pubMedIds": [
        "19454582",
        "19802898"
      ]
    }
  }
}

Clinical Assertions

Conditions object from XML path VariationArchive.ClassifiedRecord.ClinicalAssertionList

key	type	description	XML sub-path
accession	string	SCV Id from ClinVar	ClinicalAssertionList.ClinVarAccession.Accession
pubMedIds	list	list of PubMedIds	ClinicalAssertionList.ClinicalAssertion.AttributeSet.Citation.ID.Value

** XML **

<ClinicalAssertionList>
    <ClinicalAssertion ID="4172562" SubmissionDate="2023-01-11" DateLastUpdated="2023-02-07"
                       DateCreated="2022-03-28">
        <ClinVarSubmissionID localKey="12475853|MedGen:C0238198;C1861848;C0031511"
                             submittedAssembly="GRCh37"/>
        <ClinVarAccession
            Accession="SCV002152762"
            DateUpdated="2023-02-07"
            DateCreated="2022-03-28"
            Type="SCV"
            Version="2"
            SubmitterName="Invitae"
            OrgID="500031"
            OrganizationCategory="laboratory"
            OrgAbbreviation="Invitae"
        />
        <RecordStatus>current</RecordStatus>
        <Classification DateLastEvaluated="2021-08-04">
            ...
        </Classification>
        <Assertion>variation to disease</Assertion>
        <AttributeSet>
            <Attribute Type="AssertionMethod">Invitae Variant Classification Sherloc (09022015)</Attribute>
            <Citation>
                <ID Source="PubMed">28492532</ID>
            </Citation>
        </AttributeSet>
        <ObservedInList>
            ...
        </ObservedInList>
        <SimpleAllele>
            ...
        </SimpleAllele>
        <TraitSet Type="Disease">
            ...
        </TraitSet>
        <SubmissionNameList>
            ...
        </SubmissionNameList>
    </ClinicalAssertion>
</ClinicalAssertionList>

** JSON **

{
"clinicalAssertions": [
    {
      "accession": "SCV002152762",
      "pubMedIds": [
        "28492532"
      ]
    }
  ]
}

Known Issues

Known Issues

Entries with following missing/incorrect information are skipped

1. Invalid Ref Allele (example VCV000437934)
2. Invalid Alt Allele (example VCV000006637)
3. Following variant types are not supported:

   1. Variation (example VCV000001101)
   2. fusion (example VCV000015269)
   3. unknown (example VCV000017564)
   4. protein only (example VCV000132152)
   5. Complex (example VCV000221337)
   6. Translocation (example VCV000267801)
   7. no_sequence_alteration (example VCV000010504)
4. Only records of type classified are included [VCV with type included is skipped (example VCV000431749)]
5. Records with missing genomic location are skipped (example VCV000000254)

Download URLs

https://ftp.ncbi.nlm.nih.gov/pub/clinvar/xml/ClinVarVCVRelease_00-latest.xml.gz

JSON Output

small variants:

{
  "clinvar-preview": [
    {
      "altAllele": "A",
      "refAllele": "G",
      "variantType": "SNV",
      "accession": "VCV000437934",
      "version": "1",
      "recordType": "classified",
      "dateLastUpdated": "2023-08-06",
      "rcvs": [
        {
          "accession": "RCV000505090",
          "version": "1",
          "classifications": {
            "germlineClassification": {
              "reviewStatus": "no assertion criteria provided",
              "descriptions": [
                {
                  "dateLastEvaluated": "2016-08-31",
                  "classification": "Pathogenic"
                }
              ]
            }
          },
          "classifiedConditions": [
            {
              "condition": "Cleidocranial dysostosis",
              "db": "MedGen",
              "id": "C0008928"
            }
          ]
        }
      ],
      "classifications": {
        "germlineClassification": {
          "reviewStatus": "no assertion criteria provided",
          "classification": "Pathogenic",
          "dateLastEvaluated": "2016-08-31",
          "mostRecentSubmission": "2017-09-09",
          "conditions": [
            {
              "type": "Disease",
              "contributesToAggregateClassification": true,
              "traits": [
                {
                  "id": "820",
                  "name": {
                    "xRefs": [
                      {
                        "db": "Genetic Alliance",
                        "id": "Cleidocranial+Dysplasia/1683"
                      },
                      {
                        "db": "SNOMED CT",
                        "id": "65976001"
                      }
                    ],
                    "value": "Cleidocranial dysostosis"
                  }
                }
              ]
            }
          ]
        }
      },
      "clinicalAssertions": [
        {
          "accession": "SCV000598565"
        }
      ]
    }
  ]
}

large variants:

{
  "clinvar-preview": [
    {
      "chromosome": "17",
      "begin": 150732,
      "end": 14764202,
      "variantType": "copy_number_gain",
      "accession": "VCV000154089",
      "version": "2",
      "recordType": "classified",
      "dateLastUpdated": "2023-10-15",
      "rcvs": [
        {
          "accession": "RCV000142236",
          "version": "6",
          "classifications": {
            "germlineClassification": {
              "reviewStatus": "no assertion criteria provided",
              "descriptions": [
                {
                  "dateLastEvaluated": "2014-03-10",
                  "classification": "Pathogenic"
                }
              ]
            }
          },
          "classifiedConditions": [
            {
              "condition": "See cases"
            }
          ]
        }
      ],
      "classifications": {
        "germlineClassification": {
          "reviewStatus": "no assertion criteria provided",
          "classification": "Pathogenic",
          "dateLastEvaluated": "2014-03-10",
          "mostRecentSubmission": "2015-07-13",
          "conditions": [
            {
              "type": "PhenotypeInstruction",
              "contributesToAggregateClassification": true,
              "traits": [
                {
                  "id": "18728",
                  "name": {
                    "value": "See cases"
                  }
                }
              ]
            }
          ]
        }
      },
      "clinicalAssertions": [
        {
          "accession": "SCV000183512"
        }
      ]
    }
  ]
}

Field	Type	Notes
chromosome	string	Chromosome
begin	integer	start position of variant
end	integer	end of position of variant
refAllele	string
altAllele	string
accession	string	ClinVar ID
version	string	ClinVar version
variantType	string	variant type
recordType	string	record type
dateLastUpdated	string	yyyy-MM-dd
rcvs	array	RCV objects associated to this VCV
classifications	array	classifications for this VCV
clinicalAssertions	array	SCV objects associated to this VCV
isAlleleSpecific	bool	true when the current variant alternate allele matches the ClinVar alternate allele

Variant Types

• copy_number_gain
• copy_number_loss
• deletion
• delins
• duplication
• insertion
• inversion
• SNV
• tandem_duplication

Review Statuses

• criteria provided, conflicting classifications
• criteria provided, multiple submitters, no conflicts
• criteria provided, single submitter
• no assertion criteria provided
• no classification provided
• practice guideline
• reviewed by expert panel

classification

• Benign
• Likely benign
• Pathogenic
• Uncertain significance
• Likely pathogenic
• Benign/Likely benign
• not provided
• conflicting data from submitters
• Pathogenic/Likely pathogenic
• association
• Conflicting classifications of pathogenicity
• Pathogenic; risk factor
• risk factor
• other
• drug response
• Uncertain significance; Pathogenic/Likely pathogenic
• Likely pathogenic, low penetrance
• Pathogenic; Affects
• Pathogenic, low penetrance
• protective
• Affects
• Benign; other
• Conflicting classifications of pathogenicity; other
• Conflicting classifications of pathogenicity; association
• Uncertain risk allele
• Uncertain significance; risk factor
• Likely pathogenic; risk factor
• Likely benign; association
• Likely risk allele
• Pathogenic/Likely pathogenic; other
• Pathogenic; other
• Pathogenic/Likely pathogenic/Pathogenic, low penetrance
• Pathogenic/Likely pathogenic; risk factor
• Benign/Likely benign; risk factor
• Uncertain significance/Uncertain risk allele
• Pathogenic; association; protective
• protective; risk factor
• Benign/Likely benign; other; risk factor
• Benign/Likely benign; association
• Benign; association
• Affects; association; other
• Pathogenic; protective
• Conflicting classifications of pathogenicity; drug response; other
• Conflicting classifications of pathogenicity; drug response
• Benign; drug response
• Likely pathogenic; other
• Conflicting classifications of pathogenicity; protective
• Pathogenic/Likely pathogenic; drug response
• Benign/Likely benign; other
• Likely pathogenic/Likely risk allele
• Uncertain risk allele; protective
• association not found
• Affects; association
• Uncertain significance; association
• Likely benign; other
• Uncertain significance; other
• Conflicting classifications of pathogenicity; association; risk factor Pathogenic;
• association
• Benign; risk factor
• Conflicting classifications of pathogenicity; other; risk factor
• Pathogenic/Likely risk allele; risk factor
• Uncertain significance; drug response
• Conflicting classifications of pathogenicity; risk factor
• other; risk factor
• Pathogenic/Likely pathogenic/Likely risk allele
• Likely pathogenic; drug response
• Conflicting classifications of pathogenicity; Affects
• association; drug response; risk factor
• Pathogenic; drug response
• Affects; risk factor
• Pathogenic; drug response; other
• Likely pathogenic; protective
• confers sensitivity
• Likely pathogenic; association
• Benign; Affects
• Likely pathogenic; Affects
• Uncertain risk allele; risk factor
• drug response; risk factor
• Pathogenic/Likely risk allele
• Likely benign; drug response; other
• Benign/Likely benign; drug response
• Benign/Likely benign; drug response; other
• drug response; other
• association; drug response
• Pathogenic; confers sensitivity
• association; risk factor
• Pathogenic/Pathogenic, low penetrance; other
• Benign; confers sensitivity
• confers sensitivity; other
• Likely pathogenic/Pathogenic, low penetrance
• Likely benign; risk factor

Building the supplementary files

There are 2 ways of building your own OMIM supplementary files using SAUtils.

The first way is to use SAUtils command's subcommands clinvar. The ClinVar .nsa and .nsi for Illumina Connected Annotations can be built using the SAUtils command's clinvar subcommand.

The second way is to use SAUtils command's subcommands AutoDownloadGenerate. To use AutoDownloadGenerate, read more in SAUtils section.

Using clinvar subcommands and source data files

Two input .xml files and a .version file are required in order to build the .nsa and .nsi file. You should have the following files:

ClinVarVCVRelease_00-latest.xml.gz
ClinVarVCVRelease_00-latest.xml.gz.version

The version file is a json file with the following format.

{
  "name": "ClinVar",
  "version": "20240501",
  "description": "A freely accessible, public archive of reports of the relationships among human variations and phenotypes, with supporting evidence",
  "releaseDate": "2024-05-01"
}

You have to adjust the version and release date according to the actual date of the ClinVar.

Here is a sample execution:

dotnet SAUtils ClinVarPreview \
--r ~/References/7/Homo_sapiens.GRCh38.Nirvana.dat\
--vcv ClinVarVCVRelease_00-latest.xml.gz\
--o output
---------------------------------------------------------------------------
SAUtils                                             (c) 2024 Illumina, Inc.
                                                                     3.25.0
---------------------------------------------------------------------------

Parsing XML completed in 14.7 mins.
Sorting and adjusting completed in 4.7 mins.
Writing 2351609 Small Varaints
Chromosome 1 completed in 00:00:57.1
Chromosome 2 completed in 00:01:30.8
Chromosome 3 completed in 00:00:32.9
Chromosome 4 completed in 00:00:21.2
Chromosome 5 completed in 00:00:31.7
Chromosome 6 completed in 00:00:34.6
Chromosome 7 completed in 00:00:27.9
Chromosome 8 completed in 00:00:17.9
Chromosome 9 completed in 00:00:34.0
Chromosome 10 completed in 00:00:26.6
Chromosome 11 completed in 00:00:35.4
Chromosome 12 completed in 00:00:31.5
Chromosome 13 completed in 00:00:22.7
Chromosome 14 completed in 00:00:22.7
Chromosome 15 completed in 00:00:23.7
Chromosome 16 completed in 00:00:39.6
Chromosome 17 completed in 00:00:46.7
Chromosome 18 completed in 00:00:10.2
Chromosome 19 completed in 00:00:32.9
Chromosome 20 completed in 00:00:10.7
Chromosome 21 completed in 00:00:05.3
Chromosome 22 completed in 00:00:11.0
Chromosome X completed in 00:00:19.6
Chromosome Y completed in 00:00:00.1
Chromosome MT completed in 00:00:00.3
Maximum bp shifted for any variant:1
NSA writing completed in 11.5 mins.
Writing 76122 Large Varaints
Writing 76122 intervals to database...
NSI writing completed in 1.1 mins.

Time: 00:32:10.9
Process finished with exit code 0.