# CWL CLI Pipeline Execution

In this tutorial, we will demonstrate how to create and launch a pipeline using the CWL language using the ICA command line interface (CLI).

## Installation

Please refer to [these instructions](https://help.ica.illumina.com/command-line-interface/cli-installation) for installing ICA CLI.

## Tutorial project

In this project, we will create two simple tools and build a pipeline that we can run on ICA using CLI. The first tool (tool-fqTOfa.cwl) will convert a FASTQ file to a FASTA file. The second tool(tool-countLines.cwl) will count the number of lines in an input FASTA file. The workflow\.cwl will combine the two tools to convert an input FASTQ file to a FASTA file and count the number of lines in the resulting FASTA file.

Following are the two CWL tools and scripts we will use in the project. If you are new to CWL, please refer to the cwl [user guide](https://www.commonwl.org/user_guide/) for a better understanding of CWL codes. You will also need the cwltool installed to create these tools and processes. You can find installation instructions on the CWL [github](https://github.com/common-workflow-language/cwltool) page.

### tool-fqTOfa.cwl

```{cwl}
#!/usr/bin/env cwltool

cwlVersion: v1.0
class: CommandLineTool
inputs:
  inputFastq:
    type: File
    inputBinding:
        position: 1
stdout: test.fasta
outputs:
  outputFasta:
    type: File
    streamable: true
    outputBinding:
        glob: test.fasta

arguments:
- 'NR%4 == 1 {print ">" substr($0, 2)}NR%4 == 2 {print}'
baseCommand:
- awk
```

### tool-countLines.cwl

```{cwl}
#!/usr/bin/env cwltool

cwlVersion: v1.0
class: CommandLineTool
baseCommand: [wc, -l]
inputs:
  inputFasta:
    type: File
    inputBinding:
        position: 1
stdout: lineCount.tsv
outputs:
  outputCount:
    type: File
    streamable: true
    outputBinding:
        glob: lineCount.tsv
```

### workflow\.cwl

```{cwl}
cwlVersion: v1.0
class: Workflow
inputs:
  ipFQ: File

outputs:
  count_out:
    type: File
    outputSource: count/outputCount
  fqTOfaOut:
    type: File
    outputSource: convert/outputFasta
   
steps:
  convert:
    run: tool-fqTOfa.cwl
    in:
      inputFastq: ipFQ
    out: [outputFasta]

  count:
    run: tool-countLines.cwl
    in:
      inputFasta: convert/outputFasta
    out: [outputCount]
```

{% hint style="warning" %}
we don't specify the Docker image used in both tools. In such a case, the default behaviour is to use public.ecr.aws/docker/library/bash:5 image. This image contains basic functionality (sufficient to execute `wc` and `awk` commands).
{% endhint %}

If you want to use a different public image, you can specify it using *requirements* tag in cwl file. Assuming you want to use \*ubuntu:latest' you need to add

```{cwl}
requirements:
  - class: DockerRequirement
    dockerPull: ubuntu:latest
```

If you want to use a Docker image from the ICA Docker repository, you need the link to AWS ECR from ICA GUI. Double-click on the image name in the Docker repository and copy the URL to the clipboard. Add the URL to *dockerPull* key.

```{cwl}
requirements:
  - class: DockerRequirement
    dockerPull: 079623148045.dkr.ecr.eu-central-1.amazonaws.com/cp-prod/XXXXXXXXXX:latest
```

To add a custom or public docker image to the ICA repository, refer to the [Docker Repository](https://help.ica.illumina.com/home/h-dockerrepository).

## Authentication

Before you can use ICA CLI, you need to authenticate using the Illumina API key. Follow [these instructions](https://help.ica.illumina.com/command-line-interface/cli-authentication) to authenticate.

## Enter/Create a Project

Either create a project or use an existing project to create a new pipeline. You can create a new project using the `icav2 projects create` command.

```{bash}
% icav2 projects create basic-cli-tutorial --region c39b1feb-3e94-4440-805e-45e0c76462bf
```

If you do not provide the -`-region` flag, the value defaults to the existing region when there is only one region available. When there is more than one region available, a selection must be made from the available regions at the command prompt. The region input can be determined by calling the `icav2 regions list` command first.

You can select the project to work on by entering the project using the `icav2 projects enter` command. Thus, you won't need to specify the project as an argument.

```{bash}
% icav2 projects enter basic-cli-tutorial
```

You can also use the `icav2 projects list` command to determine the names and ids of the project you have access to.

```{bash}
% icav2 projects list
```

## Create a pipeline on ICA

`projectpipelines` is the root command to perform actions on pipelines in a project. The `create` command creates a pipeline in the current project.

The parameter file specifies the input with additional parameter settings for each step in the pipeline. In this tutorial, input is a FASTQ file shown inside \<dataInput> tag in the parameter file. There aren't any specific settings for the pipeline steps resulting in a parameter file below with an empty \<steps> tag. Create a parameter file (parameters.xml) with the following content using a text editor.

```{xml}
<?xml version="1.0" encoding="UTF-8" standalone="yes"?>
<pd:pipeline xmlns:pd="xsd://www.illumina.com/ica/cp/pipelinedefinition" code="" version="1.0">
    <pd:dataInputs>
        <pd:dataInput code="ipFQ" format="FASTQ" type="FILE" required="true" multiValue="false">
            <pd:label>ipFQ</pd:label>
            <pd:description></pd:description>
        </pd:dataInput>
    </pd:dataInputs>
    <pd:steps/>
</pd:pipeline>
```

The following command creates a pipeline called "cli-tutorial" using the workflow\.cwl, tools "tool-fqTOfa.cwl" and "tool-countLines.cwl" and parameter file "parameter.xml" with small storage size.

```{bash}
% icav2 projectpipelines create cwl cli-tutorial --workflow workflow.cwl --tool tool-fqTOfa.cwl --tool tool-countLines.cwl --parameter parameters.xml --storage-size small --description "cli tutorial pipeline"
```

Once the pipeline is created, you can view it using the `list` command.

```{bash}
% icav2 projectpipelines list
ID                                   	CODE                      	DESCRIPTION                                      
6779fa3b-e2bc-42cb-8396-32acee8b6338	cli-tutorial             	cli tutorial pipeline 
```

## Running the pipeline

Upload data to the project using the `icav2 projectdata upload` command. Refer to the [Data page](https://help.ica.illumina.com/project/p-data) for advanced data upload features. For this test, we will use a small FASTQ file test.fastq containing the following reads.

```{txt}
@SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
AAGTTACCCTTAACAACTTAAGGGTTTTCAAATAGA
+SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
IIIIIIIIIIIIIIIIIIIIDIIIIIII>IIIIII/
@SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=36
AGCAGAAGTCGATGATAATACGCGTCGTTTTATCAT
+SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=36
IIIIIIIIIIIIIIIIIIIIIIGII>IIIII-I)8I
@SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
AAGTTACCCTTAACAACTTAAGGGTTTTCAAATAGA
+SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
IIIIIIIIIIIIIIIIIIIIDIIIIIII>IIIIII/
@SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=36
AGCAGAAGTCGATGATAATACGCGTCGTTTTATCAT
+SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=36
IIIIIIIIIIIIIIIIIIIIIIGII>IIIII-I)8I
@SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
AAGTTACCCTTAACAACTTAAGGGTTTTCAAATAGA
+SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
IIIIIIIIIIIIIIIIIIIIDIIIIIII>IIIIII/
@SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=36
AGCAGAAGTCGATGATAATACGCGTCGTTTTATCAT
+SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=36
IIIIIIIIIIIIIIIIIIIIIIGII>IIIII-I)8I
```

The "icav2 projectdata upload" command lets you upload data to ica.

```{bash}
% icav2 projectdata upload test.fastq /
oldFilename= test.fastq en newFilename= test.fastq
bucket= stratus-gds-use1  prefix= 0a488bb2-578b-404a-e09d-08d9e3343b2b/test.fastq
Using: 1 workers to upload 1 files
15:23:32: [0]  Uploading /Users/user1/Documents/icav2_validation/for_tutorial/working/test.fastq
15:23:33: [0]  Uploaded /Users/user1/Documents/icav2_validation/for_tutorial/working/test.fastq to /test.fastq in 794.511591ms
Finished uploading 1 files in 795.244677ms

```

The `list` command lets you view the uploaded file. Note the ID of the file you want to use with the pipeline.

```{bash}
% icav2 projectdata list                
PATH          NAME        TYPE  STATUS    ID                                    OWNER                                 
/test.fastq  test.fastq FILE  AVAILABLE fil.c23246bd7692499724fe08da020b1014  4b197387-e692-4a78-9304-c7f73ad75e44
```

The `icav2 projectpipelines start` command initiates the pipeline run. The following command runs the pipeline. Write down the id for exploring the analysis later.

If for some reason your `create` command fails and needs to rerun, you might get an error (ConstraintViolationException). If so, try your command with a different name.

```{bash}
% icav2 projectpipelines start cwl cli-tutorial --type-input STRUCTURED --input ipFQ:fil.c23246bd7692499724fe08da020b1014 --user-reference tut-test
analysisStorage.description           1.2 TB
analysisStorage.id                    6e1b6c8f-f913-48b2-9bd0-7fc13eda0fd0
analysisStorage.name                  Small
analysisStorage.ownerId               8ec463f6-1acb-341b-b321-043c39d8716a
analysisStorage.tenantId              f91bb1a0-c55f-4bce-8014-b2e60c0ec7d3
analysisStorage.tenantName            ica-cp-admin
analysisStorage.timeCreated           2021-11-05T10:28:20Z
analysisStorage.timeModified          2021-11-05T10:28:20Z
id                                    461d3924-52a8-45ef-ab62-8b2a29621021
ownerId                               7fa2b641-1db4-3f81-866a-8003aa9e0818
pipeline.analysisStorage.description  1.2 TB
pipeline.analysisStorage.id           6e1b6c8f-f913-48b2-9bd0-7fc13eda0fd0
pipeline.analysisStorage.name         Small
pipeline.analysisStorage.ownerId      8ec463f6-1acb-341b-b321-043c39d8716a
pipeline.analysisStorage.tenantId     f91bb1a0-c55f-4bce-8014-b2e60c0ec7d3
pipeline.analysisStorage.tenantName   ica-cp-admin
pipeline.analysisStorage.timeCreated  2021-11-05T10:28:20Z
pipeline.analysisStorage.timeModified 2021-11-05T10:28:20Z
pipeline.code                         cli-tutorial
pipeline.description                  Test, prepared parameters file from working GUI
pipeline.id                           6779fa3b-e2bc-42cb-8396-32acee8b6338
pipeline.language                     CWL
pipeline.ownerId                      7fa2b641-1db4-3f81-866a-8003aa9e0818
pipeline.tenantId                     d0696494-6a7b-4c81-804d-87bda2d47279
pipeline.tenantName                   icav2-entprod
pipeline.timeCreated                  2022-03-10T13:13:05Z
pipeline.timeModified                 2022-03-10T13:13:05Z
reference                             tut-test-cli-tutorial-eda7ee7a-8c65-4c0f-bed4-f6c2d21119e6
status                                REQUESTED
summary                               
tenantId                              d0696494-6a7b-4c81-804d-87bda2d47279
tenantName                            icav2-entprod
timeCreated                           2022-03-10T20:42:42Z
timeModified                          2022-03-10T20:42:43Z
userReference                         tut-test
```

You can check the status of the run using the `icav2 projectanalyses get` command.

```{bash}
%   icav2 projectanalyses get 461d3924-52a8-45ef-ab62-8b2a29621021
analysisStorage.description           1.2 TB
analysisStorage.id                    6e1b6c8f-f913-48b2-9bd0-7fc13eda0fd0
analysisStorage.name                  Small
analysisStorage.ownerId               8ec463f6-1acb-341b-b321-043c39d8716a
analysisStorage.tenantId              f91bb1a0-c55f-4bce-8014-b2e60c0ec7d3
analysisStorage.tenantName            ica-cp-admin
analysisStorage.timeCreated           2021-11-05T10:28:20Z
analysisStorage.timeModified          2021-11-05T10:28:20Z
endDate                               2022-03-10T21:00:33Z
id                                    461d3924-52a8-45ef-ab62-8b2a29621021
ownerId                               7fa2b641-1db4-3f81-866a-8003aa9e0818
pipeline.analysisStorage.description  1.2 TB
pipeline.analysisStorage.id           6e1b6c8f-f913-48b2-9bd0-7fc13eda0fd0
pipeline.analysisStorage.name         Small
pipeline.analysisStorage.ownerId      8ec463f6-1acb-341b-b321-043c39d8716a
pipeline.analysisStorage.tenantId     f91bb1a0-c55f-4bce-8014-b2e60c0ec7d3
pipeline.analysisStorage.tenantName   ica-cp-admin
pipeline.analysisStorage.timeCreated  2021-11-05T10:28:20Z
pipeline.analysisStorage.timeModified 2021-11-05T10:28:20Z
pipeline.code                         cli-tutorial
pipeline.description                  Test, prepared parameters file from working GUI
pipeline.id                           6779fa3b-e2bc-42cb-8396-32acee8b6338
pipeline.language                     CWL
pipeline.ownerId                      7fa2b641-1db4-3f81-866a-8003aa9e0818
pipeline.tenantId                     d0696494-6a7b-4c81-804d-87bda2d47279
pipeline.tenantName                   icav2-entprod
pipeline.timeCreated                  2022-03-10T13:13:05Z
pipeline.timeModified                 2022-03-10T13:13:05Z
reference                             tut-test-cli-tutorial-eda7ee7a-8c65-4c0f-bed4-f6c2d21119e6
startDate                             2022-03-10T20:42:42Z
status                                SUCCEEDED
summary                               
tenantId                              d0696494-6a7b-4c81-804d-87bda2d47279
tenantName                            icav2-entprod
timeCreated                           2022-03-10T20:42:42Z
timeModified                          2022-03-10T21:00:33Z
userReference                         tut-test
```

The pipelines can be run using JSON input type as well. The following is an example of running pipelines using JSON input type. Note that JSON input works only with file-based CWL pipelines (built using code, not a graphical editor in ICA).

```{bash}
 % icav2 projectpipelines start cwl cli-tutorial --data-id fil.c23246bd7692499724fe08da020b1014 --input-json '{
  "ipFQ": {
    "class": "File",
    "path": "test.fastq"
  }
}' --type-input JSON --user-reference tut-test-json
```

## Notes

### runtime.ram and runtime.cpu

`runtime.ram` and `runtime.cpu` values are by default evaluated using the compute environment running the host CWL runner. CommandLineTool Steps within a CWL pipeline run on different compute environments than the host CWL runner, so the valuations of the `runtime.ram` and `runtime.cpu` for within the CommandLineTool will not match the runtime environment the tool is running in. The valuation of `runtime.ram` and `runtime.cpu` can be overridden by specifying `cpuMin` and `ramMin` in the `ResourceRequirements` for the CommandLineTool.
