# Sample Sheet Requirements

## Standard Sample Sheet Requirements

The following sample sheet requirements describe required and optional fields for DRAGEN TSO 500 Analysis Software. Depending on the deployment (standalone DRAGEN server, ICA with auto-launch, ICA with manual launch), certain sections and required values can deviate from the standard requirements. These deviations are noted in the information below.

{% hint style="warning" %}
The analysis fails if the sample sheet requirements are not met.
{% endhint %}

Use the following steps to create a valid sample sheet.

1. Download the sample sheet v2 template that matches the instrument & assay run.
2. In the BCL Convert Settings section, enter the following required parameters:

### \[BCLConvert\_Settings] Section

<table><thead><tr><th width="190">Sample Parameter</th><th width="146">Required</th><th>Details</th></tr></thead><tbody><tr><td>SoftwareVersion</td><td>Required</td><td>The DRAGEN component software version.<br>For DRAGEN TSO 500 v2.5.3 and v2.5.4 specify <code>3.10.16</code>.</td></tr><tr><td>AdapterRead1</td><td>Required</td><td>If using 8 bp indexes starting with UP or CP (used with <strong>TSO 500</strong>):<br>AGATCGGAAGAGCACACGTCTGAACTCCAGTCA<br><br>If using 10 bp indexes with UDP (used with <strong>TSO 500 HT</strong>):<br>CTGTCTCTTATACACATCTCCGAGCCCACGAGAC<br><br>Analysis fails if the incorrect adapter sequences are used</td></tr><tr><td>AdapterRead2</td><td>Required</td><td>If using 8 bp indexes starting with UP or CP (used with <strong>TSO 500</strong>):<br>AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT<br><br>If using 10 bp indexes with UDP (used with <strong>TSO 500 HT</strong>):<br>CTGTCTCTTATACACATCTGACGCTGCCGACGA<br><br>Analysis fails if the incorrect adapter sequences are used</td></tr><tr><td>AdapterBehavior</td><td>Required</td><td>Enter <code>trim</code> This indicates that the BCL Convert software trims the specified adapter sequences from each read.</td></tr><tr><td>MinimumTrimmedReadLength</td><td>Required</td><td>Enter <code>35</code>. Reads with a length trimmed below this point are masked.</td></tr><tr><td>MaskShortReads</td><td>Required</td><td>Enter <code>35</code>. Reads with a length trimmed below this point are masked.</td></tr></tbody></table>

3. In the BCL Convert Data section, enter the following parameters for each sample.

### \[BCLConvert\_Data] Section

<table><thead><tr><th width="192">Sample Parameter</th><th width="148">Required</th><th>Details</th></tr></thead><tbody><tr><td>Sample_ID</td><td>Required</td><td>Must match a Sample_ID listed in the TSO 500 Data section.</td></tr><tr><td>Index</td><td>Required</td><td>Index 1 sequence valid for Index_ID assigned to matching Sample_ID in the TSO 500 Data section.</td></tr><tr><td>Index2</td><td>Required</td><td>Index 2 sequence valid for Index_ID assigned to matching Sample_ID in the TSO 500 Data section.</td></tr><tr><td>Lane</td><td>Only for NovaSeq 6000 XP, NovaSeq 6000Dx, or NovaSeq X workflows</td><td>Indicates which lane corresponds to a given sample. Enter a single numeric value per row.<br>Cannot be empty, i.e the analysis fails if the Lane column is present without a value in each row.</td></tr></tbody></table>

4. In the TSO 500 Data section, enter the following parameters:

{% hint style="info" %}
TSO 500 Data Section header changes depending on the deployment:

* Standalone DRAGEN Server and ICA with Manual Launch: `TSO500S_Data`
* ICA with Auto-launch: `Cloud_TSO500S_Data`
  {% endhint %}

### \[TSO500S\_Data] Section

<table><thead><tr><th width="200">Sample Parameter</th><th width="141">Required</th><th>Details</th></tr></thead><tbody><tr><td>Sample_ID</td><td>Required</td><td>The unique ID to identify a sample. The sample ID is included in the output file names. Sample IDs are not case sensitive. Sample IDs must have the following characteristics:<br>- Unique for the run.<br>- 1–40 characters.<br>- No spaces.<br>- Alphanumeric characters with underscores and dashes. If you use an underscore or dash, enter an alphanumeric character before and after the underscore or dash. eg, Sample1-T5B1_022515.<br>- Cannot be called <code>all</code>, <code>default</code>, <code>none</code>, <code>unknown</code>, <code>undetermined</code>, <code>stats</code>, or <code>reports</code>.<br>- Must match a Sample_ID listed in the TSO 500 Data section.<br>- Illumina recommends that the sample ID be based on the pair ID. Example: <code>&#x3C;Pair_ID>-DNA,&#x3C;Pair_ID>-RNA.</code><br>- Each sample must have a unique combination of Lane (if applicable), sample ID, and index ID or the analysis will fail.</td></tr><tr><td>Sample_Type</td><td>Required</td><td>Enter <code>DNA</code> or <code>RNA</code>.<br>For HRD samples, this parameter must be <code>DNA</code>.</td></tr><tr><td>Pair_ID</td><td>Required</td><td>A unique ID that links DNA and RNA from the same biological sample from the same individual. Pair ID shares, at most, one DNA and one RNA sample per run. eg, if a Sample_ID is <code>TestSample1-DNA</code> for DNA and <code>TestSample1-RNA</code> for RNA, the Pair_ID <code>TestSample1</code> will link these samples that are on different rows in the sample sheet together.<br>If the pair ID is associated with more than one DNA or RNA sample, the analysis fails.</td></tr><tr><td>Sample_Feature</td><td>Required when using HRD add-on kit</td><td>Required for HRD enriched samples.<br>For DNA samples that have undergone HRD enrichment, enter <code>HRD</code> in this column of the sample sheet. If the sample has not undergone HRD enrichment, leave the field empty.</td></tr><tr><td>Sample_Description</td><td>Not Required</td><td>Sample description must meet the following requirements:<br>- 1–50 characters.<br>- Alphanumeric characters with underscores, dashes and spaces. If you enter a underscore, dash, or space, enter an alphanumeric character before and after. eg, Solid-FFPE_213.</td></tr></tbody></table>

To ensure a successful analysis, follow these guidelines:

1. Avoid any blank lines at the end of the sample sheet; these can cause the analysis to fail.
2. When running local analysis using the command line save the sample sheet in the sequencing run folder with the default name `SampleSheet.csv`, or choose a different name and specify the path in the command-line options.

## ICA with Auto-launch: Sample Sheet Requirements

Refer to the following requirements to create sample sheets for running the analysis on ICA with Auto-launch. For sample sheet requirements common between deployments see [Standard Sample Sheet Requirements](#standard-sample-sheet-requirements). Samples sheets can be created using BaseSpace Run Planning Tool or manually by downloading and editing a sample sheet template

### **\[Cloud\_TSO500S\_Data] Section**

Refer to [\[TSO500\_Data\] Section](#tso-500-data) for this section's requirements.

### **\[Cloud\_TSO500S\_Settings] Section**

<table><thead><tr><th width="223">Parameters</th><th width="133">Required</th><th>Details</th></tr></thead><tbody><tr><td>SoftwareVersion</td><td>Not Required</td><td>The TSO500S software version</td></tr><tr><td>StartsFromFastq</td><td>Required</td><td>Set the value to TRUE or FALSE. To auto-launch from BCL files, set to FALSE.</td></tr></tbody></table>

### \[Cloud\_Data] Section

<table><thead><tr><th width="225">Parameters</th><th width="132">Required</th><th>Details</th></tr></thead><tbody><tr><td>Sample_ID</td><td>Not Required</td><td>The same sample ID used in the Cloud_TSO500S_Data section.</td></tr><tr><td>ProjectName</td><td>Not Required</td><td>The BaseSpace project name.</td></tr><tr><td>LibraryName</td><td>Not Required</td><td>Combination of sample ID and index values in the following format: sampleID_Index_Index2</td></tr><tr><td>LibraryPrepKitName</td><td>Not Required</td><td>The Library Prep Kit used.</td></tr><tr><td>IndexAdapterKitName</td><td>Not Required</td><td>The Index Adapter Kit used.</td></tr></tbody></table>

### \[Cloud\_Settings] Section

<table><thead><tr><th width="229">Parameter</th><th width="130">Required</th><th>Details</th></tr></thead><tbody><tr><td>GeneratedVersion</td><td>Not Required</td><td>The cloud GSS version used to create the sample sheet. Optional if manually updating a sample sheet.</td></tr><tr><td>CloudWorkflow</td><td>Not Required</td><td>Ica_workflow_1</td></tr><tr><td>Cloud_TSO500_Pipeline</td><td>Required</td><td><p>This value is a universal record number (URN). The valid values are:</p><ul><li>Solid—urn:ilmn:ica:pipeline:e8eff7ef-1683-4f63-a0ba-9af542cd39e0#DRAGEN_TSO500_RUO_TISSUE_HT_v2_5_2_1_Pipeline</li><li>Solid HRD —urn:ilmn:ica:pipeline:172270e9-3678-45a9-a9f4-c9c7a0a32bb8#DRAGEN_TSO500_RUO_TISSUE_HRD_v2_5_2_1_Pipeline</li></ul></td></tr><tr><td>BCLConvert_Pipeline</td><td>Required</td><td>The value is a URN in the following format: urn:ilmn:ica:pipeline: &#x3C;pipeline-ID>#&#x3C;pipeline-name></td></tr></tbody></table>