> For the complete documentation index, see [llms.txt](https://help.connected.illumina.com/llms.txt). Markdown versions of documentation pages are available by appending `.md` to page URLs; this page is available as [Markdown](https://help.connected.illumina.com/dragen/dragen-v4.4/product-guide/dragen-v4.4/dragen-single-cell-pipeline/dragen-scrna.md).

# Other scRNA Prep

The DRAGEN scRNA Pipeline can process multiplexed single-cell RNA-Seq data sets from reads to a cell-by-gene expression matrix. The pipeline is compatible with library designs that have one read in a fragment matched to a transcript and the other containing a cell barcode and a unique molecular identifier (UMI).

The pipeline includes the following functions:

* Cell-barcode and UMI extraction and error correction for each read
* RNA-Seq (splice-aware) alignment and matching to annotated genes
* UMI counting per cell and gene to measure gene expression
* Sparse matrix output and QC metrics
* Feature counting, such as with cell-surface proteins

![](https://3555446211-files.gitbook.io/~/files/v0/b/gitbook-x-prod.appspot.com/o/spaces%2F-MflHs6hPlQAu-m5s2h_%2Fuploads%2Fgit-blob-1a4ff97572d5ba2df1f06b4e9ad0b2c50810e9df%2FscRNAworkflow.png?alt=media)

The functionality and options related to alignment and gene annotation are identical to the RNA-Seq pipeline. For information, see [DRAGEN RNA Pipeline](/dragen/dragen-v4.4/product-guide/dragen-v4.4/dragen-rna-pipeline.md). Other RNA-Seq modules, such as gene fusion calling or transcript-level gene expression quantification are not supported for Single-Cell RNA.

Note: Illumina's PIPseq technology utilizes a new and novel way for molecular counting \[1]. While file inputs and outputs are similar, the sequences described below as UMIs are used as binning indexes (BIs), and molecules are identified by a combination of BIs and intrinsic molecular identifiers (IMIs). The single-cell RNA pipeline is adapted to process these sequences when PIPseq mode is enabled with `--scrna-enable-pipseq-mode=true`. Furthermore, some arguments such as barcode positions, barcode whitelist and trimming are set automatically in PIPseq mode as well. Other than these differences, all of the additional details and options described here can also be applied to the Illumina PIPseq scRNA pipeline. Please see the [Illumina Single-Cell RNA DRAGEN Analysis Workflow](/dragen/dragen-v4.4/product-guide/dragen-v4.4/dragen-single-cell-pipeline/dragen-scrna-pipseq.md) page for more information.

## Input Files

### Alignment Reference

Use a standard DRAGEN RNA reference genome or hashtable for the scRNA Pipeline. For example, build using `--ht-build-rna-hashtable=true`. The pipeline also requires a gene annotation file in GTF format, provided with the `--annotation` (`-a`) option. It is recommended to exclude from the analysis pseudogenes and other entries that may overlap with protein-coding genes and reduce mapping accuracy. This can be done using the --annotation-file-ignore-biotypes argument, which is a comma-separated list of biotypes to exclude (allowed values are protein\_coding, pseudogene, lncrna, rrna and shortrna).

### Read Input

The DRAGEN scRNA Pipeline requires both the transcript sequence and the barcode+UMI sequence for each fragment (read) as input. The transcript sequence is aligned to the genome to determine the expressed gene, the barcode+UMI sequence is split into the single-cell barcode to identify the unique cell, and a single-cell UMI for unique molecule quantification. When starting from FASTQ, you can either include the UMI in the read name or provide separate UMI FASTQ files.

#### UMI in Read Name

Provide the transcriptome reads as a single-end FASTQ file with the Barcode+UMI sequence in the eighth field of the read-name line. Separate sequences using a colon. The following example uses read2 (`sample.R2.fastq.gz`) as the transcript read.

```
@VH00284:510:AACJNNCHV:1:1101:64888:1151:AGAGGAGTGATGGATGAAGAGTGGGTTTCGAGACAAAGAGTTCAC 2:N:0:GTGCAGACAG+ACGGATGGTA
TGCACTGACTGCTCTTCCGAAGGTCCGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTA
+
;CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
```

In the example, the sequence starting with AGA is the barcode+UMI read, the sequences beginning with GTG and ACG are the i7 and i5 sequences, respectively, and the sequence starting with TGCA is the transcriptome read.

These FASTQ files can be generated by bclConvert and bcl2fastq using the UMI settings to define the single-cell barcode+UMI read. If using bclConvert, enter the barcode/UMI information using the `OverrideCycles1` setting. For more information, see the *BCL Convert Software Guide (document # 1000000094725)*.

Note: bclConvert refers to the entire single-cell barcode+UMI sequence as UMI.

Enter the following command line option to use the generated FASTQ files from bclConvert:

```
dragen -1 <file name> --umi-source=qname
```

The option is also compatible with the `--fastq-list` input options and with read input from BAM files.

#### Single-cell RNA Fastq-list Files

A single-cell RNA fastq-list file is a CSV file with the following mandatory columns:

| Column      | Description                                                                         |
| ----------- | ----------------------------------------------------------------------------------- |
| `Lane`      | Sequencing lane                                                                     |
| `RGID`      | Read group ID                                                                       |
| `RGSM`      | Read group sample                                                                   |
| `RGLB`      | Read group library                                                                  |
| `Read1File` | Read 1 FASTQ file (usually FASTQ file with reads containing cell-barcodes and UMIs) |
| `Read2File` | Read 2 FASTQ file (usually transcriptomic reads)                                    |

In this case, DRAGEN needs to accept `--umi-source=read1` (or `--umi-source=read2` if swapped) command-line option. For example, a fastq-list file with the contents shown below must be used in combination with `--umi-source=read1` option:

```
Lane,RGID,RGSM,RGLB,Read1File,Read2File
1,rna,sample1,illumina1,scRNA1.R1.fastq.gz,scRNA1.R2.fastq.gz
2,rna,sample1,illumina2,scRNA2.R1.fastq.gz,scRNA2.R2.fastq.gz
```

Alternatively, the FASTQ file with transcriptomic reads can be specified under `Read1File` column and the FASTQ file with cell-barcodes and UMIs - under `UmiFile` column. For example, a fastq-list file with the contents shown below must be used in combination with `--umi-source=umifile` option:

```
Lane,RGID,RGSM,RGLB,Read1File,UmiFile
1,rna,sample1,illumina1,scRNA1.R2.fastq.gz,scRNA1.R1.fastq.gz
2,rna,sample1,illumina2,scRNA2.R2.fastq.gz,scRNA2.R1.fastq.gz
```

#### Separate `UMI Fastq` Files

An alternative option is to provide the transcript and barcode+UMI sequences as two separate FASTQ files. One file contains only the transcriptome reads and one contains the corresponding barcode-reads in the same order. This file is similar to how read-pairs are normally handled. If using separate UMI files, the sequencing system run setup and bclConvert are not aware of the UMI and treat it as normal read sequence by default.

Enter the following command line option to use the separate UMI FASTQ files:

```
dragen -1 <file name> --umi-fastq=<file name> --umi-source=fastq
```

To use this method with multiple FASTQ files:

1. Enter the barcode+UMI FASTQ files as read1 in the `fastq-list` file, and then enter the transcriptome read FASTQ files, matching the default fastq\_list.csv generated by bclConvert, as read2.
2. Use the following command:

```
dragen --fastq-list fastq_list.csv --umi-source=read1
```

#### Using Multiple Libraries

The scRNA pipeline can process a single biological sample per DRAGEN run. To process multiple single-cell libraries together, split the single sample into multiple single-cell libraries with a unique set of cells in each. DRAGEN keeps the cells (barcodes and UMIs) from each library separate and provides merged outputs across all. Read groups are used to specify the library for each FASTQ file using the RGLB attribute.

## DRAGEN Single-cell Settings

To use the scRNA workflow, use the options `--enable-rna=true --enable-single-cell-rna=true`. This section includes information on additional scRNA settings.

### Barcode Position

By default the scRNA workflow assumes that the overall barcode/UMI sequence is made up of a single-cell barcode (possibly split into multiple blocks) and a single UMI. Enter the following command to define the location of the single-cell barcode and single-cell UMI in the barcode read:

```
--scrna-barcode-position <blockPos>[+<blockPos>+<blockPos>...][(:-)|(:+)] --scrna-umi-position <blockPos>
```

`blockPos` describes the offset of the first and last inclusive base of the block and is formatted as `<startPos>_<endPos>`. For example, for a library with a 16 bp cell-barcode followed by a 10 bp UMI, use: `--scrna-barcode-position 0_15 --scrna-umi-position 16_25`. For a library with the cell-barcode split into three blocks of 9 bp separated by fixed linker sequences and an 8 bp UMI, use: `--scrna-barcode-position=0_8+21_29+43_51 --scrna-umi-position=52_59`.

By default, the barcode position is assumed to be indicated on the forward strand. To explicitly specify the forward strand, use: `--scrna-barcode-position 0_15:+` or `--scrna-barcode-position=0_8+21_29+43_51:+`. To explicitly specify the reverse strand, use: `--scrna-barcode-position 0_15:-` or `--scrna-barcode-position=0_8+21_29+43_51:-`.

UMI position can also be specified for feature reads, which are reads with a sequence tag specific to a feature (eg, cell-surface protein or antibody). When the feature-specific UMIs are located on Read 2, you can use `--scrna-feature-barcode-r2umi=0_11` to specify a 12 bp feature UMI at the beginning of each feature read.

### Known Barcode Lists

You can provide a list of cell barcode sequences to include using the following command:

```
--scrna-barcode-sequence-list </path/to/barcodeAllowlist.txt>
```

In the case where the `--scrna-barcode-position` parameter is not split into multiple blocks (see Barcode Position section) the file must contain one possible cell barcode sequence per line. Differently, when the barcode position is split into multiple blocks, the file must contain a list composed by multiple sections (one for each block): each section must indicate the possible cell barcode block sequences for the corresponding block. Each section should start with a line with prefix `#-`, e.g.:

```
#-Block1
<barcode_block_1_sequence_1>
<barcode_block_1_sequence_2>
...
#-Block2
<barcode_block_2_sequence_1>
<barcode_block_2_sequence_2>
...
```

The input file can also be provided compressed with gzip (`*.txt.gz`).

During cell-barcode error correction any observed barcodes that do not match a sequence specified in the file are considered errors. If possible, the barcodes are corrected to a similar allowed sequence. See [Barcode Error Correction](#barcode-error-correction) for more information. If the barcodes cannot be corrected, they are filtered out.

### Cell Filtering

DRAGEN uses a threshold on the total count of unique UMIs (or reads) per cell barcode, to determine which barcodes are likely to correspond to single-cells in the original sample, instead of background noise. The threshold is determined based on the distribution of counts along barcodes and on the expected number of true cells in the sample.

* `--single-cell-number-cells` --- \[Optional] Set the expected number of cells. The default is 3000. Adjust only if the expected number of cells is so far from the default that DRAGEN does not call the correct cell filtering threshold automatically.
* `--single-cell-threshold` --- Specify the method for determining the count threshold value. The available values are `fixed`, `ratio`, or `inflection`.
  * If using `ratio`, DRAGEN estimates the expected number of cells as `max(T_e, T_m)`. `T_m` is a threshold based on a fraction of the counts seen in most abundant cell-barcodes. `T_e` is a threshold based on a fraction of the least abundant expected cell.
  * If using `inflection`, DRAGEN estimates the count threshold by analyzing inflection points in the cumulative distribution of counts.
  * If using `fixed`, the count threshold is set to force the expected number of cells (`--single-cell-number-cells` option), rather than estimating it from the data. The exact number of passing cells might be slightly larger than the number of requested single-cells because several cells in the tail of the count distribution can have the same count.
* `--single-cell-threshold-filterby` --- \[Optional] Set the count distribution to consider for cell filtering. Can be either "umi" (default) or "read".

To set a specific, fixed number of cells, rather than use the automatically determined threshold, use the following command:

```
--single-cell-threshold=fixed --single-cell-number-cells=X
```

The command forces DRAGEN to select the top X cells and extra cells with the same number of counts of the last selected cell.

### Additional Options

The following are additional options you can use to configure the Single-Cell RNA Pipeline settings.

* `--rna-library-type` --- Set the orientation of transcript reads relative to the genomes. Enter `SF` for forward, `SR` for reverse, or `U` for unstranded. The default is `SF`.
* `--scrna-count-introns` --- Include intronic reads in gene expression estimation. The default is `false`.
* `--qc-enable-depth-metrics` --- Set to `false` to disable depth metrics for faster run time. The default is `true`.
* `--bypass-anchor-mapping` --- Set to `true` to disable RNA anchor (two-pass) mapping for increased performance. The default is `false`.
* `--scrna-global-umi` --- Set to `true` to require UMIs to be unique across all genes in a cell. Only the gene with the highest count will be considered for each UMI per cell. This option also causes all mappings of a read to be counted. The default is `false`.

## Command-line Example

The following is an example command line to run the DRAGEN Single Cell RNA Pipeline.

```bash
dragen \
--enable-rna=true \
--enable-single-cell-rna=true \
--umi-source=fastq \
--scrna-barcode-position 0_15 \
--scrna-umi-position 16_25 \
-r reference_genomes/Mus_musculus/mm10/DRAGEN/8 \
-a reference_genomes/Mus_musculus/mm10/gtf/gencode.vM23.annotation.gtf.gz \
-1 lib1_S7_L001_R2_001.fastq.gz \
--umi-fastq lib1_S7_L001_R1_001.fastq.gz \
--RGID=1 \
--RGSM=sample1 \
--output-dir=/staging/out \
--output-file-prefix=sample1
```

## Outputs

Single-cell RNA outputs are found in the standard DRAGEN output location. The files start with a `<prefix>` which may correspond to `<sample>.` in the case of a single library and `<sample>.<libId>.` in the case of multiple libraries. All single-cell RNA output files contain word `scRNA` in their names. Note that the term "molecular identifier (MI)" can refer to either UMI counts in a UMI workflow or molecule counts using the BI/IMI approach in PIPseq mode.

### Counts

The following three files provide information per-cell gene expression level in matrix market (`*.mtx`) format:

* `<prefix>.scRNA.matrix.mtx.gz`
  * Count of unique MIs for each cell/gene pair in sparse matrix format.
* `<prefix>.scRNA.barcodes.tsv.gz`
  * Cell-barcode sequence for each cell from the matrix. This includes all cell-barcodes.
* `<prefix>.scRNA.features.tsv.gz`
  * Gene name, ID and feature type for each gene and feature in the matrix.

NOTE: the legacy `<prefix>.scRNA.genes.tsv.gz` is still generated but will be deprecated in the next release.

The subset of barcodes corresponding to passing cells can be found under the Filter column in `<prefix>.scRNA.barcodeSummary.tsv` indicated by values `PASS` and `FAIL`.

The output includes filtered matrix, barcode and features files which only include the per-cell gene expression for the `PASS` cells:

* `<prefix>.scRNA.filtered.matrix.mtx.gz`
  * Count of unique MIs for each **filtered** cell/gene pair in sparse matrix format.
* `<prefix>.scRNA.filtered.barcodes.tsv.gz`
  * Cell-barcode sequence for each **filtered** cell from the matrix.
* `<prefix>.scRNA.filtered.features.tsv.gz`
  * Gene name, ID and feature type for each gene and feature in the matrix (identical to `<prefix>.scRNA.features.tsv.gz`).

#### Loading output in a dense matrix

Some users might want to explore the output matrix in a human-readable format. To do so, a possible way would be to load the matrix in a "dense" dataframe in Python (similar methodologies can be used in alternative programming languages). It is important to remember, however, that when possible a "sparse" representation of the matrix is preferable, due to the significant usage of memory and disk space of "dense" matrices. Several tools are available to work efficiently with "sparse" representations of single cell matrices (e.g., `scanpy` in Python).

The matrix can be converted into a "dense" representation through two Python modules: `scanpy` and `pandas`. This has been tested with Python 3.9.7, scanpy 1.10.3, pandas 2.2.3.

First, it is necessary to install the required libraries:

```bash
> pip install -U scanpy pandas
```

Within Python, the matrix can be loaded in "dense" representation using the following commands:

```python
# import libraries
import pandas as pd
import scanpy as sc

# define output folder and file prefix
output_folder = "output/folder"
prefix = "sample_id.scRNA."

# load matrix through scanpy
adata = sc.read_10x_mtx(output_folder, prefix=prefix)

# convert scanpy internal format (AnnData) to dense pandas DataFrame
df = pd.DataFrame(adata.X.todense(), index=adata.obs_names, columns=adata.var_names)

# save it as CSV file
df.to_csv("output_matrix.csv")
```

The matrix can be saved through different output formats (e.g., CSV), although this is not recommended due to high disk usage.

### Alignments

Alignments of the transcript reads are sorted by coordinate and output as a BAM file. The primary alignment of each read (that is considered in the workflow) is annotated with an `XB` tag containing the cell-barcode and an `RX` tag containing the UMI. The alignments use the original sequences without any errors corrected. If the cell-barcode was error-corrected, then the corrected cell-barcode will also be reported with the `CR` tag. Fragments that do not have an associated barcode read, for example fragments trimmed on the input data, do not have `XB` and `RX` tags.

### Overall Metrics

The `<prefix>.scRNA_metrics.csv` file contains per sample scRNA metrics. In scRNA, mapped reads are currently reported by default under R1 metrics, irrespective of whether R1 is the read aligned to the transcriptome or the one containing the cell barcode and UMI.

#### Barcode Read Metrics

* Invalid barcode read: Overall barcode sequence (cell barcode + UMI) failed basic checks. For example, the barcode read was missing or too short.
* Error free cell-barcode: Reads with cell-barcode sequences that were not altered during error correction. For example, if the read was an exact match to the allow list.
* Error corrected cell-barcode: Reads with cell-barcode sequences successfully corrected to a valid sequence.
* Filtered cell-barcode: Reads with cell-barcode sequences that could not be corrected to a valid sequence. For example, the sequence does not match allow list with at most one mismatch.

#### Transcript/Feature Read Metrics

* Unique exon match: Reads with valid cell-barcode and UMI that match a unique gene.
* Unique intron match: Reads do not match exons, but introns of exactly one gene. For example, if using the command `--scrna-count-introns=true`.
* Ambiguous match: Reads match to multiple genes.
* Wrong strand: Reads overlap a gene on the opposite strand defined by library type.
* Mitochondrial reads: Reads map to the mitochondrial example, if there is a matching gene.
* No gene match: Reads do not match to any gene. Includes intronic reads unless using `--scrna-count-introns=true`.
* Filtered multimapper: Reads excluded due to multiple alignment positions in the genome.
* Feature reads: Reads matching to features, when using feature counting.

#### MI count metrics

* Total counted reads: Reads with valid cell-barcode and MIs, matching a unique gene
* Reads with error-corrected molecular identifier sequences: Counted reads where the MI was error-corrected to match another similar sequence.
* Reads with invalid molecular identifier sequences: Reads that were not counted due to an invalid MI sequence. For example, pure homopolymer reads or reads containing Ns.
* Sequencing saturation: Fraction of reads with duplicate MIs. 1 - ( MIs / Reads).
* Unique cell-barcodes: Overall number of unique cell-barcode sequences in counted reads only.
* Total molecules: Overall number of unique cell-barcode and MI combinations counted.

#### Cell Metrics

* Molecule count threshold for passing cells: Number of MIs required for a cell-barcode to pass filtering. NOTE: if `--single-cell-threshold-filter-by` is set to `read` then `Read count threshold for passing cells` is reported here instead.
* Passing cells: Number of cell-barcodes that passed the filters.
* Fraction genic reads in cells: Counted reads assigned to cells that passed the filters.
* Fraction reads in passing cells: All counted reads assigned to cells that passed the filters.
* Median reads per cell: Total counted reads per cell that passed the filters.
* Median molecules per cell: Total counted MIs per cell that passed the filters.
* Median genes per cell: Genes with at least one MI per cell that passed the filters.
* Total genes detected: Genes with at least one MI in at least one cell that passed the filters.

### Per-cell metrics

The `<prefix>.scRNA.barcodeSummary.tsv` contains summary statistics for each unique cell-barcode per cell after error correction.

* ID: Unique numeric ID for the cell-barcode. The ID corresponds to the line number of that barcode in the MI count matrix (\*.mtx) output.
* Barcode: The cell-barcode sequence.
* TotalReads: Total reads with the cell-barcode sequence. This includes error corrected reads.
* GeneReads: Reads (primary read alignments) counted towards a gene.
* Molecules: Total number of MIs in counted reads.
* Genes: Unique genes detected.
* Mitochondrial Reads: Reads mapped to mitochondrial genome.
* Filter: The following are the available filter values:
  * `PASS`: Cell-barcode passes the filter.
  * `LOW`: MI count is below threshold.

## Barcode error correction

Cell-barcode sequences from the input reads are error corrected based on their frequency, and optionally through a list of expected cell-barcode sequences. A cell-barcode sequence is corrected into another cell-barcode sequence if they differ only by one base (Hamming distance 1) and:

* Either the corrected cell-barcode is at least two times more frequent across all input reads
* Or the corrected cell-barcode is on the list of expected cell-barcode sequences, but the original cell-barcode is not

When corrected, all the original cell-barcode reads are assigned to the corrected cell-barcode. The sequence error correction scheme is similar to the directional algorithm described in (Smith, Heger and Sudbery, 2020)¹.

¹Smith, T., Heger, A. and Sudbery, I., 2020. UMI-Tools: Modeling Sequencing Errors In Unique Molecular Identifiers To Improve Quantification Accuracy. \[PDF] Cold Spring Harbor Laboratory Press. Available at: <[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5340976/>](https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5340976/>) \[Accessed 15 October 2020].

To avoid overcounting UMIs based on sequence errors, UMI error correction is performed among all reads with the same cell-barcode mapping to the same gene. UMI sequences that are likely errors of another UMI are not counted.

## Genotype Sample Demultiplexing

DRAGEN implements several strategies for demultiplexing data sets that represent mixtures of cells from different individuals, such as cells pooled in one library prep or microfluidic run. Two of these strategies include a genotype-based and genotype-free demultiplexing. In genotype demultiplexing methods, DRAGEN can assign sample identity to cells based on alleles observed in reads in each cell (only SNVs are considered). DRAGEN flags any doublets, such as droplets that contain multiple cells from different individuals.

To use genotype-based sample demultiplexing, you must provide a VCF file with genotypes for each sample in the data set. To use genotype-free sample demultiplexing, you must provide a VCF file with a set of external samples preferably coming from a population with the same genetic background. The `GT` field represents the sample genotypes.

For information on the cell-hashing demultiplexing method, see [Cell-Hashing](#cell-hashing).

### Command-Line Options

You can use the following command line options for scRNA demultiplexing.

* One of the two:
  * `--scrna-demux-sample-vcf` — If using genotype-based sample demultiplexing, specify the VCF file that contains the sample genotypes.
  * `--scrna-demux-reference-vcf` — If using genotype-free sample demultiplexing, specify the VCF file that contains the genotypes of a population with a similar genetic background to the samples you are using.
* `--scrna-demux-detect-doublets` — Enable the doublet detection in genotype-based sample demultiplexing. The default value is `false`.
* `--scrna-demux-number-samples` — The number of samples you are using. This option is only applicable when using an external VCF reference specified with the `scrna-demux-reference-vcf` option, for genotype-free sample demultiplexing.

The following is an example command line to run the DRAGEN Single-Cell RNA Pipeline with genotype-based demultiplexing.

```bash
dragen \
--enable-rna=true \
--enable-single-cell-rna=true \
--umi-source=fastq \
--scrna-barcode-position 0_15 \
--scrna-umi-position 16_25 \
-r reference_genomes/Mus_musculus/mm10/DRAGEN/8 \
-a reference_genomes/Mus_musculus/mm10/gtf/gencode.vM23.annotation.gtf.gz \
-1 lib1_S7_L001_R2_001.fastq.gz \
--umi-fastq lib1_S7_L001_R1_001.fastq.gz \
--RGID=1 \
--RGSM=sample1 \
--output-dir=/staging/out \
--output-file-prefix=sample1 \
--scrna-demux-detect-doublet=true \
--scrna-demux-sample-vcf=sample.vcf
```

The following is an example command line to run the DRAGEN Single-Cell RNA Pipeline with genotype-free demultiplexing.

```bash
dragen \
--enable-rna=true \
--enable-single-cell-rna=true \
--umi-source=fastq \
--scrna-barcode-position 0_15 \
--scrna-umi-position 16_25 \
-r reference_genomes/Mus_musculus/mm10/DRAGEN/8 \
-a reference_genomes/Mus_musculus/mm10/gtf/gencode.vM23.annotation.gtf.gz \
-1 lib1_S7_L001_R2_001.fastq.gz \
--umi-fastq lib1_S7_L001_R1_001.fastq.gz \
--RGID=1 \
--RGSM=sample1 \
--output-dir=/staging/out \
--output-file-prefix=sample1 \
--scrna-demux-detect-doublet=true \
--scrna-demux-reference-vcf=sample.vcf \
--scrna-demux-number-samples=4
```

#### Outputs

You can find information related to the output of genotype-based scRNA sample demultiplexing in the following three files.

The `<prefix>.scRNA.barcodeSummary.tsv` file contains per-cell metrics, including cell barcodes. The following columns contain information on demultiplexing per-cell. See Outputs for more information on `<prefix>.scRNA.barcodeSummary.tsv` metrics.

| Column           | Description                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    |
| ---------------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- |
| `SampleIdentity` | <p>The <code>SampleIdentity</code> column can contain the following values::</p><ul><li><code>sampleX</code>—The particular cell (barcode) is uniquely assigned to a sample.</li><li><code>AMB(sampleX,sampleY)</code>—The algorithm cannot determine the sample to assign the barcode to.</li><li><code>MIX(mixing\_coef</code><em><code>sampleX+(100-mixing\_coef)sampleY)</code>—The cell barcode is classified as doublet. For example, <code>MIX(50sampleX+50</code></em><code>sampleY)</code>.</li></ul> |
| `IdentityQscore` | The IdentityQscore column contains the value used to estimate the confidence of the sample identity call. After DRAGEN determines the doublet status of the cell as `singlet`, `ambiguous`, or `doublet`, the identity Q-score is defined as -10 \* log10(Probability that the assigned identity is correct, given the second most likely identity and the doublet status). The higher values of identity Q-score correspond to more confident sample identity calls.                                          |

The `<prefix>.scRNA.demux.tsv` file contains sample demultiplexing statistics that were used to infer sample identity of each cell.

| Column                     | Description                                                                                                   |
| -------------------------- | ------------------------------------------------------------------------------------------------------------- |
| `Barcode`                  | The cell barcode associated with the cell.                                                                    |
| `DemuxSNPCount`            | The number of SNPs that the reads of the cell barcode intersect.                                              |
| `DemuxReadCount`           | Number of MIs of the cell barcode that intersect at least one SNP.                                            |
| `Pure samples`             | Samples from the VCF file.                                                                                    |
| `BestMixtureIdentity`      | Mixture sample with the highest log likelihood. Only available if `--single-cell-demux-detect-doublets=true`. |
| `BestMixtureLogLikelihood` | The log likelihood of the best mixture sample. Only available if `--single-cell-demux-detect-doublets=true`.  |

The `<prefix>.scRNA.demuxSamples_metrics.csv` file contains per-cell metrics, similar to the metrics reported for the overall dataset in `<prefix>.scRNA_metrics.csv`.

| Column                          | Description                                                  |
| ------------------------------- | ------------------------------------------------------------ |
| `Passing cells`                 | The number of cell barcodes that passed.                     |
| `Fraction genic reads in cells` | Counted reads assigned to the cells that passed.             |
| `Median reads per cell`         | Total counted reads per cell that passed the filters.        |
| `Median molecules per cell`     | Total counted MIs per cell that passed the filters.          |
| `Median genes per cell`         | Genes with at least one MI per cell that passed the filters. |

## Tumor/non-tumor Cell Demultiplexing

In addition to cell demultiplexing based on sample or population genotypes, there is an additional option to calculate read likelihoods for all scRNA reads conditioned on a given list of SNVs. The SNVs are specified by providing a somatic VCF (typically from a DNA WES tumor-normal somatic VC output). Note that the input VCF is "trusted" completely (ignoring variant call quality). The read-likelihoods are combined at the cell level and used to classify cells as tumor or non-tumor.

### Command-Line Options

* `--scrna-demux-tumor-normal-vcf` — A tumor-normal somatic variant call VCF that has tumor and normal sample columns. It is recommended for the VCF to have more than \~100 confident SNVs but that threshold may vary based on the coverage of the scRNA data. Having too few somatic variants runs the risk of not having enough scRNA reads intersecting the SNVs, leading to most cells being unclassified due to insufficient information.
* `--scrna-demux-tn-threshold` — The log-likelihood ratio threshold for classifying a cell as tumor or non-tumor. The default value is set to 2.0, but we recommend user to test control samples (e.g. high and low tumor-fraction samples) to find an optimal threshold tailored to their experimental design and sample type.

Example DRAGEN Single Cell RNA command line using genotype-based demultiplexing:

```bash
dragen \
--enable-rna=true \
--enable-single-cell-rna=true \
--umi-source=fastq \
--scrna-barcode-position="0_15" \
--scrna-umi-position="16_25" \
-r reference_genomes/Mus_musculus/mm10/DRAGEN/9 \
-a reference_genomes/Mus_musculus/mm10/gtf/gencode.vM23.annotation.gtf.gz \
-1 lib1_S7_L001_R2_001.fastq.gz \
--umi-fastq lib1_S7_L001_R1_001.fastq.gz \
--scrna-barcode-sequence-list=737K-august-2016.txt \
--RGID=1 \
--RGSM=sample1 \
--output-dir=/staging/out \
--output-file-prefix=sample1 \
--scrna-demux-detect-doublets=false \
--scrna-demux-tumor-normal-vcf=TN_somatic.vcf.gz \
--scrna-demux-tn-threshold=2
```

#### Outputs

The output for tumor/non-tumor scRNA cell demultiplexing can be found in the following three files.

The `<prefix>.scRNA.barcodeSummary.tsv` file contains per-cell metrics, including cell barcodes. The following columns contain information on demultiplexing per-cell. See Outputs for more information on `<prefix>.scRNA.barcodeSummary.tsv` metrics.

| Column           | Description                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               |
| ---------------- | ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- |
| `SampleIdentity` | <p>The <code>SampleIdentity</code> column can contain the following values::</p><ul><li><code>SNG:TUMOR' or 'SNG:NORMAL</code>—The particular cell (barcode) is uniquely classified as a tumor or non-tumor cell, respectively.</li><li><code>AMB(NORMAL,TUMOR)</code>—The algorithm has found variant-supporting reads, but the likelihoods of the cell being tumor or non-tumor are the same, and therefore an ambiguous call is made.</li><li><code>NA</code>—The cell barcode has no variant-supporting reads, so there is not enough information to make a classification.</li></ul> |
| `IdentityQscore` | The IdentityQscore column contains the value used to estimate the confidence of the sample identity call. After DRAGEN determines the identity of the cell, the identity Q-score is defined as -10 \* log10(probability of the most likely identity / (probability of the most likely identity + probability of the secound most likely identity)). Higher values of identity Q-score correspond to more confident sample identity calls.                                                                                                                                                 |

The `<prefix>.scRNA.demux.tsv` file contains demultiplexing statistics that are used to infer the identity of each cell. Only cells in which variant-supporting reads are found are recorded in this file.

| Column           | Description                                                                |
| ---------------- | -------------------------------------------------------------------------- |
| `Barcode`        | The cell barcode associated with the cell.                                 |
| `DemuxSNPCount`  | The number of variants that the reads of the cell barcode intersect.       |
| `DemuxReadCount` | The number of MIs of the cell barcode that intersect at least one variant. |
| `NORMAL`         | The log-likelihood of the cell being non-tumor                             |
| `TUMOR`          | The log-likelihood of a cell being tumor.                                  |

The `<prefix>.scRNA.demuxSamples_metrics.csv` file contains per-cell metrics, similar to the metrics reported for the overall dataset in `<prefix>.scRNA_metrics.csv`. Ambiguous calls, i.e. 'AMB(NORMAL,TUMOR)', are excluded from the calculation.

| Column                          | Description                                                                  |
| ------------------------------- | ---------------------------------------------------------------------------- |
| `Passing cells`                 | The number of cell barcodes that are PASS.                                   |
| `Fraction genic reads in cells` | Fraction of gene-coding reads assigned to PASS cells.                        |
| `Median reads per cell`         | Median count of reads per cell that passed the filters.                      |
| `Median molecules per cell`     | Median count of MIs per cell that passed the filters.                        |
| `Median genes per cell`         | Median count of genes with at least one MI per cell that passed the filters. |

## Cell-Hashing

DRAGEN implements several strategies for demultiplexing of data sets that represent mixtures of cells from different individuals, such as cells from different individuals pooled in one library prep or microfluidic run. One of these methods is a sample oligo-tag based method, referred to as cell-hashing.

To use cell-hashing, you must provide a cell-hashing CSV or FASTA reference file. In CSV format, the cell hashing file uses the following header: `id,name,read,position,sequence,type`.

* `id` — Identifier of the sample.
* `name` — Name of the sample.
* `read` — Read 1 (R1) or Read 2 (R2).
* `position` — Position on the specified read, including starting position and the length of the sample-specific oligo. For example, a position of 0\_15 represents an oligo that starts at position 0 and has a length of 15.
* `sequence` — DNA sequence of the sample-specific oligo. For example, CAGCCCGATTAAGGT.
* `type` — Type of feature. This should be set to Cell Hashing.

### Command-Line Options

To enable cell-hashing sample demultiplexing, specify the following command line options.

* `--scrna-cell-hashing-reference` --- Specify a CSV or FASTA cell-hashing reference file that contains sample-specific oligo-tags.
* `--scrna-demux-detect-doublets` --- Enable doublet detection in cell-hashing sample demultiplexing. The default value is `false`.
* `--scrna-demux-sample-fastq` --- Output sample-specific FASTQ files. See [Sample-Specific FASTQ Output Files](#sample-specific-fastq-output-files) for more information.

### Outputs

The `<prefix>.scRNA.barcodeSummary.tsv` file contains per-cell metrics, including cell barcodes. The following column in the `<prefix>.scRNA.barcodeSummary.tsv` contains cell-hashing per-cell information. For more information on the `<prefix>.scRNA.barcodeSummary.tsv` file, see [Single Cell RNA Outputs](#single-cell-rna-outputs).

| Column           | Description                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    |
| ---------------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- |
| `SampleIdentity` | <p>The <code>SampleIdentity</code> column can contain the following values::</p><ul><li><code>sampleX</code>—The particular cell (barcode) is uniquely assigned to a sample.</li><li><code>AMB(sampleX,sampleY)</code>—The algorithm cannot determine the sample to assign the barcode to.</li><li><code>MIX(mixing\_coef</code><em><code>sampleX+(100-mixing\_coef)sampleY)</code>—The cell barcode is classified as doublet. For example, <code>MIX(50sampleX+50</code></em><code>sampleY)</code>.</li></ul> |

The `<prefix>.scRNA.demux.tsv` file contains sample demultiplexing statistics that were used to infer sample identity of each cell.

| Column         | Description                                |
| -------------- | ------------------------------------------ |
| `Barcode`      | The cell barcode associated with the cell. |
| `Pure samples` | Cell-hashing read count for each sample.   |

### Sample-Specific FASTQ Output Files

If you have enabled either of the sample demultiplexing algorithms, you can output sample-specific FASTQ files after the sample identities for each cell is available using the command line option `--scrna-demux-sample-fastq`.

If `gzip` is specified, then the sample-specific output FASTQ files are compressed in gzip format. If `fastq` is specified, then the sample-specific FASTQ files are not compressed. The default option is `none`, which indicates that no sample-specific FASTQ files are produced.

## Feature Counting

Feature counting is a technique to profile the expression of proteins (e.g., cell surface proteins or antibodies). Feature reads differ from RNA reads in that their read R2 is not a transcriptomic sequence, but rather an oligo tag corresponding to a particular type of protein.

To enable feature counting, specify the following command-line options:

* `--scrna-feature-barcode-reference` — Specify a CSV or FASTA feature reference file that contains feature barcodes. The CSV file format is similar to the format used for [Cell-Hashing](#cell-hashing).
* `--scrna-feature-barcode-groups` — If feature reads are specified as separate FASTQ files, specify a comma-separated list of read groups that correspond to feature FASTQ files.

The output of feature counting is appended to the output expression matrix. The extended expression matrix contains additional rows corresponding to the features.

(NOTE: if the feature sequence is longer than 32 bp, then a slower matching algorithm will be used which may impact runtime.)

## References

1. Fontanez et al., 2024. Intrinsic molecular identifiers enable robust molecular counting in single-cell sequencing. bioRxiv 2024.10.04.616561.


---

# Agent Instructions
This documentation is published with GitBook. GitBook is the documentation platform designed so that both humans and AI agents can read, navigate, and reason over technical content effectively. Learn more at gitbook.com.

## Querying This Documentation
If you need additional information that is not directly available in this page, you can query the documentation dynamically by asking a question.

Perform an HTTP GET request on the current page URL with the `ask` query parameter, and the optional `goal` query parameter:

```
GET https://help.connected.illumina.com/dragen/dragen-v4.4/product-guide/dragen-v4.4/dragen-single-cell-pipeline/dragen-scrna.md?ask=<question>&goal=<endgoal>
```

`ask` is the immediate question: it should be specific, self-contained, and written in natural language.
`goal` is optional and describes the broader end goal you are ultimately trying to accomplish on behalf of the user. GitBook uses it to tailor the answer towards what is most useful for that goal.

The response will contain a direct answer to the question and relevant excerpts and sources from the documentation.

Use this mechanism when the answer is not explicitly present in the current page, you need clarification or additional context, or you want to retrieve related documentation sections.
