DRAGEN TSO 500 Analysis Software has optional and required fields that are required in addition to general sample sheet requirements. Follow the steps below to create a valid samplesheet.
The following sample sheet requirements describe required and optional fields for DRAGEN TSO 500 Analysis Software. Depending on the deployment (standalone DRAGEN server, ICA with auto-launch, ICA with manual launch, NovaSeq 6000Dx analysis application), certain sections and required values can deviate from the standard requirements. These deviations are noted in the information below.
The analysis fails if the sample sheet requirements are not met.
Use the following steps to create a valid sample sheet.
Download the sample sheet v2 template that matches the instrument & assay run.
In the Sequencing Settings section, enter the following required parameters:
| Sample Parameter | Required | Details |
|---|---|---|
In the BCL Convert Settings section, enter the following required parameters:
| Sample Parameter | Required | Details |
|---|---|---|
In the BCL Convert Data section, enter the following parameters for each sample.
In the TSO 500 Data section, enter the following parameters:
TSO 500 Data Section header changes depending on the deployment:
Standalone DRAGEN Server and ICA with Manual Launch: TSO500S_Data
ICA with Auto-launch: Cloud_TSO500S_Data
Illumina DRAGEN TruSight Oncology 500 (HRD) Analysis Application on NovaSeq 6000Dx: TSO500HRD_Data
Illumina DRAGEN TruSight Oncology 500 Analysis Application on NovaSeq 6000Dx (for Japan): TSO500S_Data
To ensure a successful analysis, follow these guidelines:
Avoid any blank lines at the end of the sample sheet; these can cause the analysis to fail.
When running local analysis using the command line save the sample sheet in the sequencing run folder with the default name SampleSheet.csv, or choose a different name and specify the path in the command-line options.
Refer to the following requirements to create sample sheets for running the analysis on ICA with Auto-launch. For sample sheet requirements common between deployments see Standard Sample Sheet Requirements. Samples sheets can be created using BaseSpace Run Planning Tool or manually by downloading and editing a sample sheet template
To auto-launch analysis from the sequencer run folder, ensure the StartsFromFastq and SampleSheetRequested fields are set to FALSE. To auto-launch analysis from FASTQs after BCL Convert auto-launch, StartsFromFastq and SampleSheet Requested fields must be set to TRUE
Refer to [TSO500_Data] Section for this section's requirements.
This section describes fields specific for sample sheets for NovaSeq 6000Dx Analysis Application. For more information on DRAGEN TSO 500 Analysis Software sample sheet requirements, refer to the sections above.
Mismatches between the samples and index primers can cause incorrect results due to loss of positive sample identification. Enter sample IDs and assign indexes in the sample sheet before beginning library preparation. Record sample IDs, indexes, and plate well orientation for reference during library preparation.
Refer to [TSO500S_Data] Section for this section's requirements.
For Illumina DRAGEN TruSight Oncology 500 Analysis Application on NovaSeq 6000Dx (distributed only in Japan), the section is called TSO500S_Data
| Sample Parameter | Required | Details |
|---|---|---|
| Sample Parameter | Required | Details |
|---|---|---|
| Parameters | Required | Details |
|---|---|---|
| Parameters | Required | Details |
|---|---|---|
| Parameter | Required | Details |
|---|---|---|
| Parameter Name | Required | |
|---|---|---|
LibraryPrepKits
Required
Accepted values are: TSO500 or TSO500HT
SoftwareVersion
Required
The DRAGEN component software version.
TruSight Oncology 500 2.6.0 requires 3.10.17. To ensure you are using the latest compatible version, refer to the software release notes.
AdapterRead1
Required
If using 8 bp indexes starting with UP or CP (used with TSO 500): AGATCGGAAGAGCACACGTCTGAACTCCAGTCA If using 10 bp indexes with UDP (used with TSO 500 HT): CTGTCTCTTATACACATCTCCGAGCCCACGAGAC Analysis fails if the incorrect adapter sequences are used
AdapterRead2
Required
If using 8 bp indexes starting with UP or CP (used with TSO 500): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT If using 10 bp indexes with UDP (used with TSO 500 HT): CTGTCTCTTATACACATCTGACGCTGCCGACGA Analysis fails if the incorrect adapter sequences are used
AdapterBehavior
Required
Enter trim This indicates that the BCL Convert software trims the specified adapter sequences from each read.
MinimumTrimmedReadLength
Required
Enter 35. Reads with a length trimmed below this point are masked.
MaskShortReads
Required
Enter 35. Reads with a length trimmed below this point are masked.
Sample_ID
Required
Must match a Sample_ID listed in the TSO 500 Data section.
Index
Required
Index 1 sequence valid for Index_ID assigned to matching Sample_ID in the TSO 500 Data section.
Index2
Required
Index 2 sequence valid for Index_ID assigned to matching Sample_ID in the TSO 500 Data section.
Lane
Only for NovaSeq 6000 XP, NovaSeq 6000Dx, or NovaSeq X workflows
Indicates which lane corresponds to a given sample. Enter a single numeric value per row. Cannot be empty, i.e the analysis fails if the Lane column is present without a value in each row.
Sample_ID
Required
The unique ID to identify a sample. The sample ID is included in the output file names. Sample IDs are not case sensitive. Sample IDs must have the following characteristics:
- Unique for the run.
- 1–40 characters.
- No spaces.
- Alphanumeric characters with underscores and dashes. If you use an underscore or dash, enter an alphanumeric character before and after the underscore or dash. eg, Sample1-T5B1_022515.
- Cannot be called all, default, none, unknown, undetermined, stats, or reports.
- Must match a Sample_ID listed in the TSO 500 Data section.
- Illumina recommends that the sample ID be based on the pair ID. Example: <Pair_ID>-DNA,<Pair_ID>-RNA.
- Each sample must have a unique combination of Lane (if applicable), sample ID, and index ID or the analysis will fail.
Sample_Type
Required
Enter DNA or RNA.
For HRD samples, this parameter must be DNA.
Pair_ID
Required
A unique ID that links DNA and RNA from the same biological sample from the same individual. Pair ID shares, at most, one DNA and one RNA sample per run. eg, if a Sample_ID is TestSample1-DNA for DNA and TestSample1-RNA for RNA, the Pair_ID TestSample1 will link these samples that are on different rows in the sample sheet together.
If the pair ID is associated with more than one DNA or RNA sample, the analysis fails.
Sample_Feature
Required when using HRD add-on kit
Required for HRD enriched samples.
For DNA samples that have undergone HRD enrichment, enter HRD in this column of the sample sheet. If the sample has not undergone HRD enrichment, leave the field empty.
Sample_Description
Not Required
Sample description must meet the following requirements: - 1–50 characters. - Alphanumeric characters with underscores, dashes and spaces. If you enter a underscore, dash, or space, enter an alphanumeric character before and after. eg, Solid-FFPE_213.
SoftwareVersion
Not Required
The TSO500S software version
StartsFromFastq
Required
Set the value to TRUE or FALSE. To auto-launch from BCL files, set to FALSE. To auto-launch from FASTQ files after auto-launch of BCL Convert, set to TRUE.
SampleSheetRequested
Required
Set the value to TRUE or FALSE.
To auto-launch from BCL files, set to FALSE. To auto-launch from FASTQ files after auto-launch of BCL Convert, set to TRUE.
Sample_ID
Not Required
The same sample ID used in the Cloud_TSO500S_Data section.
ProjectName
Not Required
The BaseSpace project name.
LibraryName
Not Required
Combination of sample ID and index values in the following format: sampleID_Index_Index2
LibraryPrepKitName
Required
The Library Prep Kit used.
IndexAdapterKitName
Not Required
The Index Adapter Kit used.
GeneratedVersion
Not Required
The cloud GSS version used to create the sample sheet. Optional if manually updating a sample sheet.
CloudWorkflow
Not Required
Ica_workflow_1
Cloud_TSO500_Pipeline
Required
This value is a universal record number (URN . The valid values are: Solid—urn:ilmn:ica:pipeline:8538a5e3-b8d2-469d-baaf-b2164e54cc51#DRAGEN_TruSight_Oncology_500_v2_6_0_2 Solid HRD —urn:ilmn:ica:pipeline:506f136e-980e-427d-ab39-f91654255bea#DRAGEN_TruSight_Oncology_500_HRD_v2_6_0_2
BCLConvert_Pipeline
Required
The value is a URN in the following format: urn:ilmn:ica:pipeline: <pipeline-ID>#<pipeline-name>
SoftwareVersion
Required
Enter the IRM iapp software version 2.6.0-2v12ui