A sample sheet is required for each analysis with DRAGEN TruSight Oncology 500 Analysis Software. A sample sheet is a comma-separated value (*.csv) file format used by Illumina instruments, platforms, and analysis pipelines to store settings and data for sequencing and analysis. The DRAGEN TruSight Oncology 500 Analysis Software is compatible with the sample sheet v2. For general information on the sample sheet v2, refer to Illumina Connected Software - Sample Sheet.
The sample sheet includes a list of samples and their index sequences, along with additional information required to run DRAGEN TruSight Oncology 500 Analysis Software. For example, DNA samples with the TruSight Oncology 500 HRD add-on probes must be indicated in the Sample Feature column of the sample sheet. Appropriate index adapter sequences are determined by the assay used to perform analysis.
When running analysis on a standalone DRAGEN server or on ICA, a valid sample sheet can be created by:
BaseSpace Run Planner (preferred), see Sample Sheet Creation in BaseSpace Run Planner page for details
Downloading and modifying a sample sheet template following the requirements, see Sample Sheet Requirements page for details
The run set up section of this guide includes specific instructions to plan a run and set up a valid sample sheet for each deployment of DRAGEN TruSight Oncology 500 Analysis Software.
DRAGEN TSO 500 Analysis Software has optional and required fields that are required in addition to general sample sheet requirements. Follow the steps below to create a valid samplesheet.
The following sample sheet requirements describe required and optional fields for DRAGEN TSO 500 Analysis Software. Depending on the deployment (standalone DRAGEN server, ICA with auto-launch, ICA with manual launch), certain sections and required values can deviate from the standard requirements. These deviations are noted in the information below.
The analysis fails if the sample sheet requirements are not met.
Use the following steps to create a valid sample sheet.
Download the sample sheet v2 template that matches the instrument & assay run.
In the BCL Convert Settings section, enter the following required parameters:
SoftwareVersion
Required
The DRAGEN component software version.
For DRAGEN TSO 500 v2.5.3 and v2.5.4 specify 3.10.16.
AdapterRead1
Required
If using 8 bp indexes starting with UP or CP (used with TSO 500): AGATCGGAAGAGCACACGTCTGAACTCCAGTCA If using 10 bp indexes with UDP (used with TSO 500 HT): CTGTCTCTTATACACATCTCCGAGCCCACGAGAC Analysis fails if the incorrect adapter sequences are used
AdapterRead2
Required
If using 8 bp indexes starting with UP or CP (used with TSO 500): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT If using 10 bp indexes with UDP (used with TSO 500 HT): CTGTCTCTTATACACATCTGACGCTGCCGACGA Analysis fails if the incorrect adapter sequences are used
AdapterBehavior
Required
Enter trim This indicates that the BCL Convert software trims the specified adapter sequences from each read.
MinimumTrimmedReadLength
Required
Enter 35. Reads with a length trimmed below this point are masked.
MaskShortReads
Required
Enter 35. Reads with a length trimmed below this point are masked.
In the BCL Convert Data section, enter the following parameters for each sample.
Sample_ID
Required
Must match a Sample_ID listed in the TSO 500 Data section.
Index
Required
Index 1 sequence valid for Index_ID assigned to matching Sample_ID in the TSO 500 Data section.
Index2
Required
Index 2 sequence valid for Index_ID assigned to matching Sample_ID in the TSO 500 Data section.
Lane
Only for NovaSeq 6000 XP, NovaSeq 6000Dx, or NovaSeq X workflows
Indicates which lane corresponds to a given sample. Enter a single numeric value per row. Cannot be empty, i.e the analysis fails if the Lane column is present without a value in each row.
In the TSO 500 Data section, enter the following parameters:
TSO 500 Data Section header changes depending on the deployment:
Standalone DRAGEN Server and ICA with Manual Launch: TSO500S_Data
ICA with Auto-launch: Cloud_TSO500S_Data
Sample_ID
Required
The unique ID to identify a sample. The sample ID is included in the output file names. Sample IDs are not case sensitive. Sample IDs must have the following characteristics:
- Unique for the run.
- 1–40 characters.
- No spaces.
- Alphanumeric characters with underscores and dashes. If you use an underscore or dash, enter an alphanumeric character before and after the underscore or dash. eg, Sample1-T5B1_022515.
- Cannot be called all, default, none, unknown, undetermined, stats, or reports.
- Must match a Sample_ID listed in the TSO 500 Data section.
- Illumina recommends that the sample ID be based on the pair ID. Example: <Pair_ID>-DNA,<Pair_ID>-RNA.
- Each sample must have a unique combination of Lane (if applicable), sample ID, and index ID or the analysis will fail.
Sample_Type
Required
Enter DNA or RNA.
For HRD samples, this parameter must be DNA.
Pair_ID
Required
A unique ID that links DNA and RNA from the same biological sample from the same individual. Pair ID shares, at most, one DNA and one RNA sample per run. eg, if a Sample_ID is TestSample1-DNA for DNA and TestSample1-RNA for RNA, the Pair_ID TestSample1 will link these samples that are on different rows in the sample sheet together.
If the pair ID is associated with more than one DNA or RNA sample, the analysis fails.
Sample_Feature
Required when using HRD add-on kit
Required for HRD enriched samples.
For DNA samples that have undergone HRD enrichment, enter HRD in this column of the sample sheet. If the sample has not undergone HRD enrichment, leave the field empty.
Sample_Description
Not Required
Sample description must meet the following requirements: - 1–50 characters. - Alphanumeric characters with underscores, dashes and spaces. If you enter a underscore, dash, or space, enter an alphanumeric character before and after. eg, Solid-FFPE_213.
To ensure a successful analysis, follow these guidelines:
Avoid any blank lines at the end of the sample sheet; these can cause the analysis to fail.
When running local analysis using the command line save the sample sheet in the sequencing run folder with the default name SampleSheet.csv, or choose a different name and specify the path in the command-line options.
Refer to the following requirements to create sample sheets for running the analysis on ICA with Auto-launch. For sample sheet requirements common between deployments see Standard Sample Sheet Requirements. Samples sheets can be created using BaseSpace Run Planning Tool or manually by downloading and editing a sample sheet template
Refer to [TSO500_Data] Section for this section's requirements.
SoftwareVersion
Not Required
The TSO500S software version
StartsFromFastq
Required
Set the value to TRUE or FALSE. To auto-launch from BCL files, set to FALSE.
Sample_ID
Not Required
The same sample ID used in the Cloud_TSO500S_Data section.
ProjectName
Not Required
The BaseSpace project name.
LibraryName
Not Required
Combination of sample ID and index values in the following format: sampleID_Index_Index2
LibraryPrepKitName
Not Required
The Library Prep Kit used.
IndexAdapterKitName
Not Required
The Index Adapter Kit used.
GeneratedVersion
Not Required
The cloud GSS version used to create the sample sheet. Optional if manually updating a sample sheet.
CloudWorkflow
Not Required
Ica_workflow_1
Cloud_TSO500_Pipeline
Required
This value is a universal record number (URN). The valid values are:
Solid—urn:ilmn:ica:pipeline:e8eff7ef-1683-4f63-a0ba-9af542cd39e0#DRAGEN_TSO500_RUO_TISSUE_HT_v2_5_2_1_Pipeline
Solid HRD —urn:ilmn:ica:pipeline:172270e9-3678-45a9-a9f4-c9c7a0a32bb8#DRAGEN_TSO500_RUO_TISSUE_HRD_v2_5_2_1_Pipeline
BCLConvert_Pipeline
Required
The value is a URN in the following format: urn:ilmn:ica:pipeline: <pipeline-ID>#<pipeline-name>
The BaseSpace Sequence Hub Run Planning tool is available and is used to generate a valid sample sheet in v2 format for use on a TSO 500 supported sequencer for both ICA and Standalone DRAGEN Server analysis options. Filling out the form on the user interface will produce a exportable sample sheet with the required fields filled in. Refer to ICA Auto-launch Sample Sheet Requirements for descriptions of fields that appear in ICA sample sheets.
The sections below represent each step in the BaseSpace Run Planning tool.
Run Name
Required
Run Name can contain 255 alphanumeric characters, dashes, underscores, periods, and spaces; and must start with an alphanumeric, a dash or an underscore.
Run Description
Optional
Run Description can contain 255 characters except square brackets, asterisks, and commas.
Instrument Platform
Required
Choose from TSO 500 supported instruments:
NextSeq 500/550
NovaSeq 6000/6000Dx
Secondary Analysis
Required
BaseSpace/Illumina Connected Analytics (to generate sample sheet for cloud analysis)
Local
Sample Container ID
Optional
Unique Identifier for the container that holds the sample
Application
Required
DRAGEN TruSight Oncology 500 Analysis Software - 2.5.x (with HRD)
DRAGEN TruSight Oncology 500 Analysis Software - 2.5.x
Description
Optional
Optional text field
Library Prep Kit
Required
TruSight Oncology 500
TruSight Oncology 500 High Throughput
Index Adapter Kit
Required
TSO 500:
TruSight Oncology 500 (NovaSeq 6000Dx, NovaSeq X, NextSeq 1000/2000)
TruSight Oncology 500 (NovaSeq 6000, NextSeq 550)
TSO 500 HT:
TruSight Oncology 500 (NovaSeq 6000Dx, NovaSeq X, NextSeq1000/2000)
TruSight Oncology 500 (NovaSeq 6000, NextSeq 550)
Users can manually enter sample information, or download a template file to bulk upload sample information. Users can import the completed template or a compatible sample sheet.
Read Lengths: Read 1 and Read 2
Required
Auto filled with the standard values, but can be optionally overwritten.
Lane Usage
Optional
Checkbox allows users to apply the same lane across samples.
Lane
Required if Lane Usage is unchecked
Specify lanes for each sample. The unmarked checkbox at the top of the dropdown selects all lanes.
Pair ID
Required
The identifier used to pair DNA and RNA samples in a run. The field is mandatory whether a sample is part of a pair, or not.
To note: The Sample ID field in the generated samplesheet will be auto-filled based on the Pair ID values captured. “_dna” and “_rna” (for DNA and RNA samples respectively) will be appended to the Pair ID value to create the Sample ID.
DNA Index ID
Required
Index set ID options are based on selected Index Adapter Kit
DNA Sample Feature
Required for TSO 500 HRD
Column appears when TSO 500 HRD application is selected. Enter for HRD enriched DNA Samples
RNA Index ID
Required
Index set ID options are based on selected Index Adapter Kit
Project
Optional
Optional field to describe the associated project
Starts from Fastq
Required
True or False
If auto-launching TSO 500 from BCL files, set the value to False.
Once all details are captured and pass validation, the user can review the details on the Run Review screen. From here they can choose to edit details in previous screens or export the sample sheet. Once completed, press the Cancel button to finish run planning.
Note: once leaving this screen, the run and sample sheet will not be accessible.
Please review these guided examples of analysis workflows that include a step of setting up a run in BaseSpace Run Planning tool:
Sample Sheet templates for TSO 500 v2.5.x standalone DRAGEN server and ICA manual launch analysis can be found in the table below. For auto-launch compatible sample sheets, use BaseSpace Run Planner.
DRAGEN TSO 500 analysis software is compatible with several instruments and assay workflows (standard, XP), each of which have implications for the sample sheet.
Sample sheet templates contain all required fields, including index sequences in the proper orientation for all indexes from a given library prep kit. The templates are provided as a starting point for creating a sample sheet manually when launching analysis on a standalone DRAGEN server or on ICA using manual launch.
For interactive run planning or to create a sample sheet for ICA Auto-launch, use BaseSpace Run Planner to create valid sample sheets for either local or cloud analysis. To set up a run in BaseSpace run planner, refer to Sample Sheet Creation in BaseSpace Run Planner.
Users can visit the Sample Sheet guidelines section to learn additional details on required fields and values as they fill-in their sample information. Use the lookup table below to select and download the sample sheet template that matches your instrument, assay, and workflow configuration:
TSO500
NextSeq 550
Standard
TSO500 + HRD
NextSeq 550
Standard
TSO500 + HRD
NovaSeq 6000
Standard
TSO500 + HRD
NovaSeq 6000Dx (in RUO mode)
Standard
TSO500 HT
NovaSeq 6000
Standard
TSO500 HT
NovaSeq 6000
XP*
TSO500 HT
NovaSeq 6000Dx (in RUO mode)
Standard
TSO500 HT
NovaSeq 6000Dx (in RUO mode)
XP*
*Lane numbers cannot exceed what is supported by the flow cell in use.