A sample sheet is required for each analysis with DRAGEN TruSight Oncology 500 Analysis Software. A sample sheet is a comma-separated value (*.csv) file format used by Illumina instruments, platforms, and analysis pipelines to store settings and data for sequencing and analysis. The DRAGEN TruSight Oncology 500 Analysis Software is compatible with the sample sheet v2. For general information on the sample sheet v2, refer to Illumina Connected Software - Sample Sheet.
The sample sheet includes a list of samples and their index sequences, along with additional information required to run DRAGEN TruSight Oncology 500 Analysis Software. For example, DNA samples with the TruSight Oncology 500 HRD add-on probes must be indicated in the Sample Feature column of the sample sheet. Appropriate index adapter sequences are determined by the assay used to perform analysis.
When running analysis on a standalone DRAGEN server or on ICA, a valid sample sheet can be created by:
BaseSpace Run Planner (preferred), see Sample Sheet Creation in BaseSpace Run Planner page for details
Downloading and modifying a sample sheet template following the requirements, see Sample Sheet Requirements page for details
When running analysis using a NovaSeq 6000Dx Analysis Application, a valid sample sheet can be created by:
Using the user interface of the DRAGEN TruSight Oncology 500 Analysis Application, see Run Planning on Illumina Run Manager for details
Downloading and modifying a sample sheet template following the requirements (see Sample Sheet Requirements page for details), then importing it to Illumina Run Manager.
The run set up section of this guide includes specific instructions to plan a run and set up a valid sample sheet for each deployment of DRAGEN TruSight Oncology 500 Analysis Software.
The following instructions describe steps to set up a run on NovaSeq 6000Dx Analysis Application.
Use the following steps to configure a TruSight™ Oncology 500 run in Illumina Run Manager:
Go to the "Runs" section of Illumina Run Manager by selecting "Runs" on the left-hand side
Enter sample data manually or by importing a sample sheet
To enter sample data run manually, select “Create Run”
Choose "DRAGEN TruSight™ Oncology 500 (with HRD) Analysis Application" from the "Create Run" screen to set-up and analyze runs for TruSight Oncology 500 assay with or without HRD add-on
On the "Run Settings" screen, enter a run name with the following criteria:
1 - 40 characters.
Alphanumeric characters, underscores, or dashes only.
Unique across all runs on the instrument.
The run name identifies the run from sequencing through analysis.
[Optional] Enter a run description. The run description must have the following criteria:
1 - 50 characters.
Alphanumeric characters or spaces only.
Spaces must be preceded and followed by an alphanumeric character.
Select kit used during library preparation:
TruSight Oncology 500
TruSight Oncology 500 High-Throughput
Index adapter kit will be automatically selected based on the library prep kit selection
[Optional] Enter a library tube ID.
Depending on the library prep kit selected, additional fields will be populated for run settings and are not editable. Read and index lengths will differ between library prep kit type.
Use the table on the "Sample Data" screen to enter sample information manually.
Alternately, select Import Samples to upload sample information. Refer to NovaSeq 6000Dx Analysis Application: Sample Sheet Requirements for sample sheet requirements.
Select lane information. Options include one to four, or all lanes.
Enter a unique sample ID in the sample ID field with the following criteria:
Controls should be added first.
1 - 40 characters.
Alphanumeric characters, underscores, or dashes only.
Underscores and dashes must be preceded and followed by an alphanumeric character.
Select an index set ID for the DNA / RNA library prepared from the sample.
[Optional] Enter a library name.
Depending on the options selected for index set ID, additional fields will be auto-populated for sample data and are not editable.
Use the table on the "Sample Settings" screen to enter additional sample information.
Enter Pair ID with the following criteria:
1 - 40 characters.
Alphanumeric characters, underscores, or dashes only.
Underscores and dashes must be preceded and followed by an alphanumeric character.
Pairs at most one DNA and one RNA samples from the same biological sample from the same individual.
Select Sample Type: DNA or RNA
Enter Sample Feature: Select HRD for DNA samples with HRD probes. For all other samples, leave the field blank.
[Optional] Enter a sample name with the following criteria:
1 - 50 characters.
Alphanumeric characters, dashes, underscores, or spaces.
Spaces, underscores, and dashes must be preceded and followed by an alphanumeric character.
[Optional] Enter a sample description with the following criteria:
1 - 50 characters.
Alphanumeric characters, dashes, underscores, or spaces.
Spaces, underscores, and dashes must be preceded and followed by an alphanumeric character.
Additional fields will be auto-populated based on selections made in the Sample Data screen, which are not editable.
Before starting your run, review that the information entered is correct in the “Run Review” page before saving.
DRAGEN TSO 500 Analysis Software has optional and required fields that are required in addition to general sample sheet requirements. Follow the steps below to create a valid samplesheet.
The following sample sheet requirements describe required and optional fields for DRAGEN TSO 500 Analysis Software. Depending on the deployment (standalone DRAGEN server, ICA with auto-launch, ICA with manual launch, NovaSeq 6000Dx analysis application), certain sections and required values can deviate from the standard requirements. These deviations are noted in the information below.
The analysis fails if the sample sheet requirements are not met.
Use the following steps to create a valid sample sheet.
Download the sample sheet v2 template that matches the instrument & assay run.
In the Sequencing Settings section, enter the following required parameters:
LibraryPrepKits
Required
Accepted values are: TSO500 or TSO500HT
In the BCL Convert Settings section, enter the following required parameters:
SoftwareVersion
Required
The DRAGEN component software version.
TruSight Oncology 500 2.6.0 requires 3.10.17. To ensure you are using the latest compatible version, refer to the software release notes.
AdapterRead1
Required
If using 8 bp indexes starting with UP or CP (used with TSO 500): AGATCGGAAGAGCACACGTCTGAACTCCAGTCA If using 10 bp indexes with UDP (used with TSO 500 HT): CTGTCTCTTATACACATCTCCGAGCCCACGAGAC Analysis fails if the incorrect adapter sequences are used
AdapterRead2
Required
If using 8 bp indexes starting with UP or CP (used with TSO 500): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT If using 10 bp indexes with UDP (used with TSO 500 HT): CTGTCTCTTATACACATCTGACGCTGCCGACGA Analysis fails if the incorrect adapter sequences are used
AdapterBehavior
Required
Enter trim This indicates that the BCL Convert software trims the specified adapter sequences from each read.
MinimumTrimmedReadLength
Required
Enter 35. Reads with a length trimmed below this point are masked.
MaskShortReads
Required
Enter 35. Reads with a length trimmed below this point are masked.
In the BCL Convert Data section, enter the following parameters for each sample.
Sample_ID
Required
Must match a Sample_ID listed in the TSO 500 Data section.
Index
Required
Index 1 sequence valid for Index_ID assigned to matching Sample_ID in the TSO 500 Data section.
Index2
Required
Index 2 sequence valid for Index_ID assigned to matching Sample_ID in the TSO 500 Data section.
Lane
Only for NovaSeq 6000 XP, NovaSeq 6000Dx, or NovaSeq X workflows
Indicates which lane corresponds to a given sample. Enter a single numeric value per row. Cannot be empty, i.e the analysis fails if the Lane column is present without a value in each row.
In the TSO 500 Data section, enter the following parameters:
TSO 500 Data Section header changes depending on the deployment:
Standalone DRAGEN Server and ICA with Manual Launch: TSO500S_Data
ICA with Auto-launch: Cloud_TSO500S_Data
Illumina DRAGEN TruSight Oncology 500 (HRD) Analysis Application on NovaSeq 6000Dx: TSO500HRD_Data
Sample_ID
Required
The unique ID to identify a sample. The sample ID is included in the output file names. Sample IDs are not case sensitive. Sample IDs must have the following characteristics:
- Unique for the run.
- 1–40 characters.
- No spaces.
- Alphanumeric characters with underscores and dashes. If you use an underscore or dash, enter an alphanumeric character before and after the underscore or dash. eg, Sample1-T5B1_022515.
- Cannot be called all, default, none, unknown, undetermined, stats, or reports.
- Must match a Sample_ID listed in the TSO 500 Data section.
- Illumina recommends that the sample ID be based on the pair ID. Example: <Pair_ID>-DNA,<Pair_ID>-RNA.
- Each sample must have a unique combination of Lane (if applicable), sample ID, and index ID or the analysis will fail.
Sample_Type
Required
Enter DNA or RNA.
For HRD samples, this parameter must be DNA.
Pair_ID
Required
A unique ID that links DNA and RNA from the same biological sample from the same individual. Pair ID shares, at most, one DNA and one RNA sample per run. eg, if a Sample_ID is TestSample1-DNA for DNA and TestSample1-RNA for RNA, the Pair_ID TestSample1 will link these samples that are on different rows in the sample sheet together.
If the pair ID is associated with more than one DNA or RNA sample, the analysis fails.
Sample_Feature
Required when using HRD add-on kit
Required for HRD enriched samples.
For DNA samples that have undergone HRD enrichment, enter HRD in this column of the sample sheet. If the sample has not undergone HRD enrichment, leave the field empty.
Sample_Description
Not Required
Sample description must meet the following requirements: - 1–50 characters. - Alphanumeric characters with underscores, dashes and spaces. If you enter a underscore, dash, or space, enter an alphanumeric character before and after. eg, Solid-FFPE_213.
To ensure a successful analysis, follow these guidelines:
Avoid any blank lines at the end of the sample sheet; these can cause the analysis to fail.
When running local analysis using the command line save the sample sheet in the sequencing run folder with the default name SampleSheet.csv, or choose a different name and specify the path in the command-line options.
Refer to the following requirements to create sample sheets for running the analysis on ICA with Auto-launch. For sample sheet requirements common between deployments see Standard Sample Sheet Requirements. Samples sheets can be created using BaseSpace Run Planning Tool or manually by downloading and editing a sample sheet template
To auto-launch analysis from the sequencer run folder, ensure the StartsFromFastq and SampleSheetRequested fields are set to FALSE. To auto-launch analysis from FASTQs after BCL Convert auto-launch, StartsFromFastq and SampleSheet Requested fields must be set to TRUE
Refer to [TSO500_Data] Section for this section's requirements.
SoftwareVersion
Not Required
The TSO500S software version
StartsFromFastq
Required
Set the value to TRUE or FALSE. To auto-launch from BCL files, set to FALSE. To auto-launch from FASTQ files after auto-launch of BCL Convert, set to TRUE.
SampleSheetRequested
Required
Set the value to TRUE or FALSE.
To auto-launch from BCL files, set to FALSE. To auto-launch from FASTQ files after auto-launch of BCL Convert, set to TRUE.
Sample_ID
Not Required
The same sample ID used in the Cloud_TSO500S_Data section.
ProjectName
Not Required
The BaseSpace project name.
LibraryName
Not Required
Combination of sample ID and index values in the following format: sampleID_Index_Index2
LibraryPrepKitName
Required
The Library Prep Kit used.
IndexAdapterKitName
Not Required
The Index Adapter Kit used.
GeneratedVersion
Not Required
The cloud GSS version used to create the sample sheet. Optional if manually updating a sample sheet.
CloudWorkflow
Not Required
Ica_workflow_1
Cloud_TSO500_Pipeline
Required
This value is a universal record number (URN . The valid values are: Solid—urn:ilmn:ica:pipeline:8538a5e3-b8d2-469d-baaf-b2164e54cc51#DRAGEN_TruSight_Oncology_500_v2_6_0_2 Solid HRD —urn:ilmn:ica:pipeline:506f136e-980e-427d-ab39-f91654255bea#DRAGEN_TruSight_Oncology_500_HRD_v2_6_0_2
BCLConvert_Pipeline
Required
The value is a URN in the following format: urn:ilmn:ica:pipeline: <pipeline-ID>#<pipeline-name>
This section describes fields specific for sample sheets for NovaSeq 6000Dx Analysis Application. For more information on DRAGEN TSO 500 Analysis Software sample sheet requirements, refer to the sections above.
Mismatches between the samples and index primers can cause incorrect results due to loss of positive sample identification. Enter sample IDs and assign indexes in the sample sheet before beginning library preparation. Record sample IDs, indexes, and plate well orientation for reference during library preparation.
SoftwareVersion
Required
Enter the IRM iapp software version 2.6.0-2v12ui
Refer to [TSO500S_Data] Section for this section's requirements.
Here are the articles in this section:
Sample Sheet templates for TSO 500 v2.6.0 standalone DRAGEN server and ICA manual launch analysis can be found in the table below. For auto-launch compatible sample sheets, use BaseSpace Run Planner.
DRAGEN TSO 500 analysis software is compatible with several instruments and assay workflows (standard, XP), each of which have implications for the sample sheet.
Sample sheet templates contain all required fields, including index sequences in the proper orientation for all indexes from a given library prep kit. The templates are provided as a starting point for creating a sample sheet manually when launching analysis on a standalone DRAGEN server or on ICA using manual launch.
For interactive run planning or to create a sample sheet for ICA Autolaunch, use to create valid sample sheets for either local or cloud analysis. To set up a run in BaseSpace run planner, refer to .
Users can visit the section to learn additional details on required fields and values as they fill-in their sample information. Use the lookup table below to select and download the sample sheet template that matches your instrument, assay, and workflow configuration:
*Lane numbers cannot exceed what is supported by the flow cell in use.
TSO500
NextSeq 550
Standard
TSO500 + HRD
NextSeq 550
Standard
TSO500 + HRD
NovaSeq 6000
Standard
TSO500 + HRD
NovaSeq 6000Dx (in RUO mode)
Standard
TSO500 HT
NextSeq 1000 / 2000
Standard
TSO500 HT
NovaSeq 6000
Standard
TSO500 HT
NovaSeq 6000
XP*
TSO500 HT
NovaSeq 6000Dx (in RUO mode)
Standard
TSO500 HT
NovaSeq 6000Dx (in RUO mode)
XP*
TSO500 HT
NovaSeq X
Standard
TSO500 HT
NovaSeq X
XP*
The BaseSpace Sequence Hub Run Planning tool is available, and is used to generate a valid sample sheet in v2 format for use on a TSO 500 supported sequencer for both ICA and Standalone DRAGEN Server analysis options. Filling out the form on the user interface will produce a exportable sample sheet with the required fields filled in. Refer to ICA Auto-launch Sample Sheet Requirements for descriptions of fields that appear in ICA sample sheets.
The sections below represent each step in the BaseSpace Run Planning tool.
Note that NovaSeq X Series has a different run set up configuration screen than other instrument platforms. TSO 500 does not support multi analysis, and in order to run TSO 500 on NovaSeq X Series, enter the appropriate Read 1, Read 2, Index 1 and Index 2 described in the instructions below.
BaseSpace Run Planning tool cannot generate a valid sample sheet for NovaSeq 6000Dx Analysis Application. Refer to Sample Sheet Requirements page to create a valid sample sheet.
Run Name
Required
Run Name can contain 255 alphanumeric characters, dashes, underscores, periods, and spaces; and must start with an alphanumeric, a dash or an underscore.
Run Description
Optional
Run Description can contain 255 characters except square brackets, asterisks, and commas.
Instrument Platform
Required
Choose from TSO 500 supported instruments:
NextSeq 500/550
NextSeq 1000/2000
NovaSeq 6000/6000Dx
NovaSeq X Series
Secondary Analysis
Required
BaseSpace/Illumina Connected Analytics (to generate sample sheet for cloud analysis)
Local
Read 1
Required on Instrument Platform NovaSeq X Series
Fill with value 101 for TSO 500 analysis
Index 1
Required on Instrument Platform NovaSeq X Series
Fill the value depending on the TSO 500 assay used:
TSO 500 HT: 10
TSO 500: 8
Index 2
Required on Instrument Platform NovaSeq X Series
Fill the value depending on the TSO 500 assay used:
TSO 500 HT: 10
TSO 500: 8
Read 2
Required on Instrument Platform NovaSeq X Series
Fill with value 101 for TSO 500 analysis
Sample Container ID
Optional
Unique Identifier for the container that holds the sample
Note: On NovaSeq X Series, this page is called "Configuration 1". The right hand corner of the UI displays the Read 1, Read 2, Index 1 and Index 2 entered on the previous run settings screen.
Application*
Required
DRAGEN TruSight Oncology 500 Analysis Software - 2.6.0 (with HRD)
DRAGEN TruSight Oncology 500 Analysis Software - 2.6.0
Description
Optional
Optional text field
Library Prep Kit
Required
TruSight Oncology 500
TruSight Oncology 500 High Throughput
Index Adapter Kit
Required
TSO 500:
TruSight Oncology 500 (NovaSeq6000Dx with S1, S2, S4, or SP Flow Cell, NextSeq1000/2000, NovaSeqX Series)
TruSight Oncology 500 (NovaSeq6000, NextSeq)
TSO 500 HT:
TruSight Oncology 500 High Throughput (NovaSeq6000Dx with S1, S2, S4, or SP Flow Cell, NextSeq1000/2000, NovaSeqX Series)
TruSight Oncology 500 High Throughput (NovaSeq6000, NextSeq)
Users can manually enter sample information, or download a template file to bulk upload sample information. Users can import the completed template or a compatible sample sheet.
Read Lengths: Read 1 and Read 2
Required Not applicable on NovaSeq X Series
Auto filled with the standard values, but can be optionally overwritten.
Override Cycles
Required on NovaSeq X Series
Entered based on Run Settings read lengths & index 1 / index 2
Lane Usage
Not applicable on NovaSeq X Series or NextSeq 1000 / 2000
Checkbox allows users to apply the same lane across samples.
Lane
Required if Lane Usage is unchecked Not applicable on NextSeq 1000 / 2000
Specify lanes for each sample. The unmarked checkbox at the top of the dropdown selects all lanes.
Pair ID
Required
The identifier used to pair DNA and RNA samples in a run. The field is mandatory whether a sample is part of a pair, or not.
To note: The Sample ID field in the generated samplesheet will be auto-filled based on the Pair ID values captured. “_dna” and “_rna” (for DNA and RNA samples respectively) will be appended to the Pair ID value to create the Sample ID.
DNA Index ID
Required
Index set ID options are based on selected Index Adapter Kit
DNA Sample Feature
Required for TSO 500 HRD
Column appears when TSO 500 HRD application is selected. Enter for HRD enriched DNA Samples
RNA Index ID
Required
Index set ID options are based on selected Index Adapter Kit
Project
Optional
Optional field to describe the associated project
Starts from Fastq
Required
True or False
If auto-launching TSO 500 from BCL files, set the value to False. If auto-launching TSO 500 from FASTQ after auto-launching BCL Convert, set the value to True.
DNA Barcode Mismatches Index 1**
DNA Barcode Mismatches Index 2**
RNA Barcode Mismatches Index 1**
RNA Barcode Mismatches Index 2**
Required on NovaSeq X
Default value is set to 1.
These fields are required by NovaSeq X and represent BCL Convert settings for index diversity checks when demultiplexing. These values are not used in TSO 500 analysis.
Once all details are captured and pass validation, the user can review the details on the Run Review screen. From here they can choose to edit details in previous screens or export the sample sheet. Once completed, press the Cancel button to finish run planning.
Note: once leaving this screen, the run and sample sheet will not be accessible.
For NovaSeqX Plus users, the run can be saved as a draft or as a planned run (via “Save as Draft” and “Save as Planned” buttons respectively). Either selection will save the run to the Planned Runs screen on BaseSpace. There is no option to export the sample sheet on this screen.
The Planned Runs screen lists all planned or drafted runs. Users can set drafted runs to planned, export the sample sheet, and edit or delete a run on this screen.
Once the run is saved as Planned, it will appear on the NovaSeq X Series instrument where it can be selected for sequencing.
For more information on run planning, refer to the BaseSpace Sequence Hub support site page.
Please review these guided examples of analysis workflows that include a step of setting up a run in BaseSpace Run Planning tool: