Sample Sheet Requirements

DRAGEN TSO 500 Analysis Software has optional and required fields that are required in addition to general sample sheet requirements. Follow the steps below to create a valid samplesheet.

Standard Sample Sheet Requirements

The following sample sheet requirements describe required and optional fields for DRAGEN TSO 500 Analysis Software. Depending on the deployment (standalone DRAGEN server, ICA with auto-launch, ICA with manual launch, NovaSeq 6000Dx analysis application), certain sections and required values can deviate from the standard requirements. These deviations are noted in the information below.

The analysis fails if the sample sheet requirements are not met.

Use the following steps to create a valid sample sheet.

1. Download the sample sheet v2 template that matches the instrument & assay run.

2. In the Sequencing Settings section, enter the following required parameters:

[Sequencing_Settings] Section

Sample Parameter	Required	Details
LibraryPrepKits	Required	Accepted values are: TSO500 or TSO500HT

1. In the BCL Convert Settings section, enter the following required parameters:

[BCLConvert_Settings] Section

Sample Parameter	Required	Details
SoftwareVersion	Required	The DRAGEN component software version. TruSight Oncology 500 2.6.0 requires 3.10.17. To ensure you are using the latest compatible version, refer to the software release notes.
AdapterRead1	Required	If using 8 bp indexes starting with UP or CP (used with TSO 500): AGATCGGAAGAGCACACGTCTGAACTCCAGTCA If using 10 bp indexes with UDP (used with TSO 500 HT): CTGTCTCTTATACACATCTCCGAGCCCACGAGAC Analysis fails if the incorrect adapter sequences are used
AdapterRead2	Required	If using 8 bp indexes starting with UP or CP (used with TSO 500): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT If using 10 bp indexes with UDP (used with TSO 500 HT): CTGTCTCTTATACACATCTGACGCTGCCGACGA Analysis fails if the incorrect adapter sequences are used
AdapterBehavior	Required	Enter trim This indicates that the BCL Convert software trims the specified adapter sequences from each read.
MinimumTrimmedReadLength	Required	Enter 35. Reads with a length trimmed below this point are masked.
MaskShortReads	Required	Enter 35. Reads with a length trimmed below this point are masked.

1. In the BCL Convert Data section, enter the following parameters for each sample.

[BCLConvert_Data] Section

Sample Parameter	Required	Details
Sample_ID	Required	Must match a Sample_ID listed in the TSO 500 Data section.
Index	Required	Index 1 sequence valid for Index_ID assigned to matching Sample_ID in the TSO 500 Data section.
Index2	Required	Index 2 sequence valid for Index_ID assigned to matching Sample_ID in the TSO 500 Data section.
Lane	Only for NovaSeq 6000 XP, NovaSeq 6000Dx, or NovaSeq X workflows	Indicates which lane corresponds to a given sample. Enter a single numeric value per row. Cannot be empty, i.e the analysis fails if the Lane column is present without a value in each row.

1. In the TSO 500 Data section, enter the following parameters:

TSO 500 Data Section header changes depending on the deployment:

• Standalone DRAGEN Server and ICA with Manual Launch: TSO500S_Data

• ICA with Auto-launch: Cloud_TSO500S_Data

• Illumina DRAGEN TruSight Oncology 500 (HRD) Analysis Application on NovaSeq 6000Dx: TSO500HRD_Data

• Illumina DRAGEN TruSight Oncology 500 Analysis Application on NovaSeq 6000Dx (for Japan): TSO500S_Data

[TSO500S_Data] Section

Sample Parameter	Required	Details
Sample_ID	Required	The unique ID to identify a sample. The sample ID is included in the output file names. Sample IDs are not case sensitive. Sample IDs must have the following characteristics: - Unique for the run. - 1–40 characters. - No spaces. - Alphanumeric characters with underscores and dashes. If you use an underscore or dash, enter an alphanumeric character before and after the underscore or dash. eg, Sample1-T5B1_022515. - Cannot be called all, default, none, unknown, undetermined, stats, or reports. - Must match a Sample_ID listed in the TSO 500 Data section. - Illumina recommends that the sample ID be based on the pair ID. Example: <Pair_ID>-DNA,<Pair_ID>-RNA. - Each sample must have a unique combination of Lane (if applicable), sample ID, and index ID or the analysis will fail.
Sample_Type	Required	Enter DNA or RNA. For HRD samples, this parameter must be DNA.
Pair_ID	Required	A unique ID that links DNA and RNA from the same biological sample from the same individual. Pair ID shares, at most, one DNA and one RNA sample per run. eg, if a Sample_ID is TestSample1-DNA for DNA and TestSample1-RNA for RNA, the Pair_ID TestSample1 will link these samples that are on different rows in the sample sheet together. If the pair ID is associated with more than one DNA or RNA sample, the analysis fails.
Sample_Feature	Required when using HRD add-on kit	Required for HRD enriched samples. For DNA samples that have undergone HRD enrichment, enter HRD in this column of the sample sheet. If the sample has not undergone HRD enrichment, leave the field empty.
Sample_Description	Not Required	Sample description must meet the following requirements: - 1–50 characters. - Alphanumeric characters with underscores, dashes and spaces. If you enter a underscore, dash, or space, enter an alphanumeric character before and after. eg, Solid-FFPE_213.

To ensure a successful analysis, follow these guidelines:

1. Avoid any blank lines at the end of the sample sheet; these can cause the analysis to fail.

2. When running local analysis using the command line save the sample sheet in the sequencing run folder with the default name SampleSheet.csv, or choose a different name and specify the path in the command-line options.

ICA with Auto-launch: Sample Sheet Requirements

Refer to the following requirements to create sample sheets for running the analysis on ICA with Auto-launch. For sample sheet requirements common between deployments see Standard Sample Sheet Requirements. Samples sheets can be created using BaseSpace Run Planning Tool or manually by downloading and editing a sample sheet template

To auto-launch analysis from the sequencer run folder, ensure the StartsFromFastq and SampleSheetRequested fields are set to FALSE. To auto-launch analysis from FASTQs after BCL Convert auto-launch, StartsFromFastq and SampleSheet Requested fields must be set to TRUE

[Cloud_TSO500S_Data] Section

Refer to [TSO500_Data] Section for this section's requirements.

[Cloud_TSO500S_Settings] Section

Parameters	Required	Details
SoftwareVersion	Not Required	The TSO500S software version
StartsFromFastq	Required	Set the value to TRUE or FALSE. To auto-launch from BCL files, set to FALSE. To auto-launch from FASTQ files after auto-launch of BCL Convert, set to TRUE.
SampleSheetRequested	Required	Set the value to TRUE or FALSE. To auto-launch from BCL files, set to FALSE. To auto-launch from FASTQ files after auto-launch of BCL Convert, set to TRUE.

[Cloud_Data] Section

Parameters	Required	Details
Sample_ID	Not Required	The same sample ID used in the Cloud_TSO500S_Data section.
ProjectName	Not Required	The BaseSpace project name.
LibraryName	Not Required	Combination of sample ID and index values in the following format: sampleID_Index_Index2
LibraryPrepKitName	Required	The Library Prep Kit used.
IndexAdapterKitName	Not Required	The Index Adapter Kit used.

[Cloud_Settings] Section

Parameter	Required	Details
GeneratedVersion	Not Required	The cloud GSS version used to create the sample sheet. Optional if manually updating a sample sheet.
CloudWorkflow	Not Required	Ica_workflow_1
Cloud_TSO500_Pipeline	Required	This value is a universal record number (URN . The valid values are: Solid—urn:ilmn:ica:pipeline:8538a5e3-b8d2-469d-baaf-b2164e54cc51#DRAGEN_TruSight_Oncology_500_v2_6_0_2 Solid HRD —urn:ilmn:ica:pipeline:506f136e-980e-427d-ab39-f91654255bea#DRAGEN_TruSight_Oncology_500_HRD_v2_6_0_2
BCLConvert_Pipeline	Required	The value is a URN in the following format: urn:ilmn:ica:pipeline: <pipeline-ID>#<pipeline-name>

NovaSeq 6000Dx Analysis Application: Sample Sheet Requirements

This section describes fields specific for sample sheets for NovaSeq 6000Dx Analysis Application. For more information on DRAGEN TSO 500 Analysis Software sample sheet requirements, refer to the sections above.

Mismatches between the samples and index primers can cause incorrect results due to loss of positive sample identification. Enter sample IDs and assign indexes in the sample sheet before beginning library preparation. Record sample IDs, indexes, and plate well orientation for reference during library preparation.

[BCLConvert_Settings] Section

Parameter Name	Required
SoftwareVersion	Required	Enter the IRM iapp software version 2.6.0-2v12ui

[TSO500HRD_Data] Section

Refer to [TSO500S_Data] Section for this section's requirements.

For Illumina DRAGEN TruSight Oncology 500 Analysis Application on NovaSeq 6000Dx (distributed only in Japan), the section is called TSO500S_Data