LogoLogo
Illumina KnowledgeIllumina SupportSign In
  • Home
  • Start Here
  • Overview
    • Software Overview
    • What's New
    • FAQ
    • Technical Assistance
    • Release Notes
    • Data Model
    • Account Types
    • Professional Services
  • Automate
    • Data Automation Overview
    • Automatic Data Flow
    • Automatic Data Aggregation
      • Unlock Biosamples
      • Correct Aggregation
    • Request A Lab Requeue
    • Yield
    • Yield Examples
      • Example 1
      • Example 2
      • Example 3
    • Automate Lane QC
    • Manual QC
    • Statuses
  • Manage Data
    • Import Demo Data
    • Delete Data
    • Import Data Into Projects
      • FastQ Upload Requirements
    • Download Data
      • Download Individual Files
      • Download Datasets
      • Download Run Files
      • Download Project Files
      • Download Analysis Files
      • Download Samples
    • Copy Datasets
    • Transfer Ownership
    • Archival Storage
    • Automatic Data Deletion
  • Sequence
    • Sample Sheets
      • Mapping Sequencing Runs to Biosamples
    • Fix Indexes
    • Plan Runs
      • Plan a NextSeq 1000/2000 Run
        • Set up NextSeq 1000/2000 Secondary Analysis
        • Custom Noise Baseline File
      • Plan a NovaSeq X Series Run
        • Set up NovaSeq X Series Secondary Analysis
        • NovaSeq X Series Custom Reference File
      • Create a Custom Index Adapter Kit
      • Import samples
      • Requeue a Planned Run
      • Analysis Configuration Template
      • Prep Tab
        • Create Biological Samples
        • Import Biological Samples
        • Prep Libraries
        • Import Sample Libraries
        • Set Up a Custom Library Prep Kit
        • Pool Libraries
        • Plan Run Using Prep Tab
        • Neo Prep
          • Configure
          • Assign Wells
          • Review
  • Microarray
    • Getting Started
      • Troubleshooting iScan Integration
    • Analysis Setup
    • Data Management
  • Analyze
    • Analyze Data
    • Launching Apps
    • Analysis Workflows
    • Re-Launch Analysis
    • Auto Analysis QC
    • Basespace Apps
  • Collaborate
    • Sharing Data
    • Access Shared Data
    • Share with Collaborators
      • Share Analyses
      • Track Analysis Delivery Status
      • Share By Link
      • Share By Email
      • Manage Collaborator Access
      • Data Access After Share / Transfer
    • Workgroups
    • Manage Workgroups
      • Access Workgroups
      • Create a Workgroup and Assign Admins
      • Rename a Workgroup
      • Add Users to a Workgroup
      • Remove Users from a Workgroup
      • Add Admins to a Workgroup
      • Remove Admins from a Workgroup
      • Manage User Access
  • Manage Your Account
    • Change Password
    • iCredits and Billing
    • Generate Usage Reports
    • Manage Enterprise Domains
    • Global Regions
  • Developer Tools
    • Basespace API
    • Developer Tools
  • Files Used By Basespace
    • Biosample Workflow Files
    • BAM Files
    • FastQ Files
    • Quality Scores
    • VCF Files
    • gVCF Files
  • Data
    • View Data
      • View Runs
        • View Run Summary
        • View Run Biosamples
        • View Run Samples
        • View Run Charts
        • View Run Metrics
        • View Run Indexing QC
        • View Run Samplesheet
        • View Run Files
      • View Projects
      • View Analyses
      • View Biosamples
  • Projects
    • Create a Project
    • Edit Project Details
  • Runs
    • Fix Sample Sheet
    • Automated Run Zipping
  • Biosamples
    • Biosample Overview
    • Manage Biosamples
    • Biosample Workflow
      • Add Biosamples
      • Add Prep Requests
      • Add Analysis Workflows to an Existing Biosample
      • Schedule Multiple Analysis Workflows for a Biosample
      • Schedule Analysis Workflow - Multiple Biosamples
    • Associating Biosamples with Projects
  • Samples
    • Combine Samples
    • Copy Samples
  • Cmd Line Interfaces
    • Basespace CLI
      • Introduction to Basemount
  • Additional Resources
    • Additional Resources
      • Informatics Blog
      • Coverage Calculator
      • Support Bulletins
      • Training
      • Security Model
      • Data Streaming
      • AWS
  • Releases
    • Previous Releases
      • 2025
        • 7.34.0 - Deletion of Custom Reference Genomes
        • 7.33.0 - Shared BCL Convert Section
        • 7.32.0 - File Preview in Search
        • 7.31.0 - Usage Explorer
        • 7.30.0 - Prep Tab Deprecation
      • 2024
        • 7.29.0 - Improved Analysis Error Reporting
        • 7.28.0 - MiSeq i100 Support
        • 7.27.0 - App Store Upgrade
        • 7.26.0 - Prep Tab Obsolescence Notification
        • 7.25.0 - Project Column in the Analysis Files Tab
        • 7.24.0 - Requeue Improvements
        • 7.23.0 - BaseSpace CLI v1.6.0
        • 7.22.0 - Analysis Autolaunch for NovaSeq X Manual Mode Runs
        • 7.21.0 - Improved Look and Feel
        • 7.20.0 - Analysis List Improvements
        • 7.19.0 - Transfer of NovaSeq X Projects
        • 7.18.0 - Custom Kit Deletion
      • 2023
        • 7.17.0 - Deletion of Biosample Default Projects
        • 7.16.0 - Transfer of NovaSeq X Runs
        • 7.15.0 - Compatibility Filtering in Run Planning
        • 7.14.0 - Native App Engine Update
        • 7.13.0 - Sharing for NovaSeq X Runs and Analyses
        • 7.12.0 - Combined New and Classic Modes
        • 7.11.0 - NovaSeq X Analysis Requeue
        • 7.10.0 - NovaSeq X Analysis Autolaunch Improvements
        • 7.9.0 - Multi-Analysis Run Planning
        • 7.8.0 - Performance Improvements
      • 2022
        • 7.7.0 - NovaSeqX Support
        • 7.6.0 - Custom Configuration Files in Microarray Analysis Setup
        • 7.5.0 - Performance Enhancements
        • 7.4.0 - Run Planning Enhancements
        • 7.3.0 - Improve App Launch Performance
        • 7.2.0 - FastQ Generation and other Bug Fixes
        • 7.1.0 - FastQ Related Fixes and Performance Improvements
        • 7.0.0 - Datasets and Apps Performance
        • 6.19.0 - ICA Integration Enhancements
        • 6.18.0 - ICA Integration with BCL Convert
        • 6.17.0 - Preliminary ICA Integration
      • 2021
        • 6.16.0
        • 6.15.0
        • 6.14.0
        • 6.13.0
        • 6.12.0
        • 6.11.0
        • 6.10.0
        • 6.9.0
        • 6.8.0
        • 6.7.0
        • 6.6.0
        • 6.5.0
      • 2020
        • 6.4.0
        • 6.3.0
        • 6.2.0
        • 6.1.0
        • 6.0.0
        • 5.46.0
        • 5.45.0
        • 5.44.0
        • 5.43.0
        • 5.42.0
      • 2019
        • 5.41.0
        • 5.40.0
        • 5.39.0
        • 5.38.0
        • 5.37.0
        • 5.36.0
        • 5.35.0
        • 5.34.0
        • 5.33.0
        • 5.32.0
        • 5.31.0
        • 5.30.0
      • 2018
        • 5.29.0
        • 5.28.0
        • 5.27.0
        • 5.26.0
        • 5.25.0
        • 5.24.0
        • 5.23.0
        • 5.22.0
        • 5.21.1
        • 5.21.0
        • 5.20.0
        • 5.19.0
        • 5.18.0
        • 5.17.0
        • 5.16.0
        • 5.15.0
        • 5.14.0
        • 5.13.0
        • 5.12.0
        • 5.11.0
      • 2017
        • 5.10.0
        • 5.9.0
        • 5.8.0
        • 5.7.0
        • 5.6.0
        • 5.5.0
        • 5.4.0
        • 5.3.0
        • 5.2.0
        • 5.1.0
        • 5.0.0
        • 4.27.0
        • 4.26.0
        • 4.25.0
        • 4.24.0
        • 4.23.0
        • 4.22.0
        • 4.21.0
        • 4.20.0
        • 4.19.0
        • 4.18.0
        • 4.17.0
        • 4.16.0
        • 4.15.0
      • 2016
        • 4.14.0
        • 4.13.0
        • 4.12.0
        • 4.11.0
        • 4.10.0
        • 4.9.0
        • 4.8.0
        • 4.7.0
        • 4.6.0
        • 4.5.0
        • 4.4.0
        • 4.3.0
        • 4.2.0
        • 4.1.0
        • 4.0.4
        • 4.0.3
        • 4.0.2
        • 4.0.1
        • 4.0.0
      • 2015
        • 3.23.2
        • 3.23.1
        • 3.23.0 Issues
        • 3.23.0
        • 3.20.4
        • 3.20.3
        • 3.20.0
        • 3.19.1
        • 3.19.0
        • 3.18.0
        • 3.17.1
        • 3.17.0
        • 3.16.2
        • 3.16.0
        • 3.15.2
        • 3.15.1
    • Release notifications
Powered by GitBook
On this page
  • Detailed Description
  • Naming
  • Compression
  • Format
  • Control values

Was this helpful?

Export as PDF
  1. Files Used By Basespace

FastQ Files

BaseSpace Sequence Hub converts *.bcl files into FASTQ files, which contain base call and quality information for all reads that pass filtering.

BaseSpace Sequence Hub automatically generates FASTQ files in sample sheet-driven workflow apps. Other apps that perform alignment and variant calling also automatically use FASTQ files.

FASTQ files can be used as sequence input for alignment and other secondary analysis software. Do not use them with tools that are not compatible with the FASTQ format.

Detailed Description

Naming

FASTQ files are named with the sample name and the sample number, which is a numeric assignment based on the order that the sample is listed in the sample sheet. Example: Data\Intensities\BaseCalls\samplename_S1_L001_R1_001.fastq.gz

  • samplename - The sample name provided in the sample sheet. If a sample name is not provided, the file name includes the sample ID, which is a required field in the sample sheet and must be unique.

  • S1 — The sample number based on the order that samples are listed in the sample sheet starting with 1. In this example, S1 indicates that this sample is the first sample listed in the sample sheet.

Reads that cannot be assigned to any sample are written to a FASTQ file for sample number 0, and excluded from downstream analysis.

  • L001—The lane number.

  • R1—The read. In this example, R1 means Read 1. For a paired-end run, there is at least one file with R2 in the file name for Read 2.

  • 001—The last segment is always 001.

Compression

FASTQ files are saved compressed in the GNU zip format (an open source file compression program), indicated by the .gz file extension.

Format

Each entry in a FASTQ file consists of four lines:

  • Sequence identifier

  • Sequence

  • Quality score identifier line (consisting only of a +)

  • Quality score

For the Undetermined FASTQ files only, the sequence observed in the index read is written to the FASTQ header in place of the sample number. This information can be useful for troubleshooting demultiplexing.

@<instrument>:<run number>:<flowcell ID>:<lane>:<tile>:<x-pos>:<y-pos> <read>:<is filtered>:<control number>:<sample number>

The following table describes the elements:

Element

Requirements

Description

@

@

Each sequence identifier line starts with @

<instrument>

Characters allowed: a–z, A–Z, 0–9 and underscore

Instrument ID

<run number>

Numerical

Run number on instrument

<flowcell ID>

Characters allowed: a–z, A–Z, 0–9

Flowcell ID

<lane>

Numerical

Lane number

<tile>

Numerical

Tile number

<x_pos>

Numerical

X coordinate of cluster

<y_pos>

Numerical

Y coordinate of cluster

<read>

Numerical

Read number. 1 can be single read or Read 2 of paired-end

<is filtered>

Y or N

Y if the read is filtered (did not pass), N otherwise

<control number>

Numerical

0 when none of the control bits are on, otherwise it is an even number. On HiSeq X systems, control specification is not performed and this number is always 0.

<sample number>

Numerical

Sample number from sample sheet

An example of a valid entry is as follows; note the space preceding the read number element:

	@SIM:1:FCX:1:15:6329:1045 1:N:0:2
	TCGCACTCAACGCCCTGCATATGACAAGACAGAATC
	+
	<>;##=><9=AAAAAAAAAA9#:<#<;<<<????#=

Control values

If the read is not identified as a control, then the 10th column (<control number>) is zero. If the read is identified as a control, the number is greater than zero, and the value specifies what type of control it is. The value is the decimal representation of a bit-wise encoding scheme. In that scheme bit 0 has a decimal value of 1, bit 1 a value of 2, bit 2 a value of 4, and so on.

PreviousBAM FilesNextQuality Scores

Last updated 1 year ago

Was this helpful?