Read Structure
The Illumina miRNA Prep Kit is a single-end read solution that includes adapters and Unique Molecular Indices (UMIs). These UMIs tag each miRNA at an early stage, reducing PCR and sequencing bias.
The 3′ adapter sequence (AACTGTAGGCACCATCAAT) is followed by the random UMI sequence, which is typically a 12 bp long random sequence. This is immediately followed by the TruSeq adapter sequence (AGATCGGAAGAGCACACGTCTGAACTCCAGTCA)

The Truseq adapter sequence is removed at the demultiplexing stage (via BCLConvert) prior to secondary analysis.
The 3’ adapter sequence is removed at the secondary analysis step, after trimming, reads are classified accordingly:
Reads are processed with cutadapt to remove 3′ UMI adapter and low-quality bases.
Reads lacking 3’ UMI adapter sequence are separately tallied as no_adapter_reads.
Insert and UMI identification After trimming, insert and UMI sequences are extracted. Reads with inserts shorter than 16 bp (too_short_reads) or UMIs shorter than 10 bp (UMI_defective_reads) are discarded
Last updated
Was this helpful?

